RchiOBHm_Chr2g0113881

Oxidation resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
25986234 .. 25987813
1580 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48719

Sequence Viewer

Length: 264 bp
ATGTATAGTTGCAAGGAAATTCGAGCAAAGGGTGCCAACCGCTACTTCACATTGTGCGCTACTGCCTTTTTAGCTATTGGTGGTGGTGGTCATTTTGCACTCTATTTGAACAGTGATCTATTGAGTGGATCAACTTCAGTTTCAGAAACCTATGGGAATCCATGTCTTGCAAACTCACTAGACTTTGATGTGAAAGAAGTAGAGGGTTTATGGGGTTTTGTGTATGCTACTAAGTATGAGGCACCTGGGATTTGCCGATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.49

Weight (kDa)

5.66

Isoelectric Point (pI)

30.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TLD PF07534 8 - 73 6.9e-11 TLDc domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 32, 241
AciI CCGC 1 cut(s) 40
AclWI GGATC 1 cut(s) 136
AcsI RAATTY 1 cut(s) 18
AcuI CTGAAG 1 cut(s) 120
AdeI CACNNNGTG 1 cut(s) 54
AgsI TTSAA 1 cut(s) 109
AjnI CCWGG 1 cut(s) 244
AjuI GAANNNNNNNTTGG 2 cut(s) 29, 61
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwI GGATC 1 cut(s) 136
ApoI RAATTY 1 cut(s) 18
AspLEI GCGC 1 cut(s) 59
BanI GGYRCC 2 cut(s) 32, 241
BccI CCATC 1 cut(s) 252
BciT130I CCWGG 1 cut(s) 246
BfaI CTAG 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 246
BmiI GGNNCC 2 cut(s) 34, 243
BmrFI CCNGG 1 cut(s) 246
BsaJI CCNNGG 1 cut(s) 245
BseBI CCWGG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 245
BshNI GGYRCC 2 cut(s) 32, 241
Bsp143I GATC 2 cut(s) 115, 128
BspACI CCGC 1 cut(s) 40
BspLI GGNNCC 2 cut(s) 34, 243
BspPI GGATC 1 cut(s) 136
BspT107I GGYRCC 2 cut(s) 32, 241
BssECI CCNNGG 1 cut(s) 245
BssMI GATC 2 cut(s) 115, 128
Bst2UI CCWGG 1 cut(s) 246
Bst4CI ACNGT 1 cut(s) 113
BstAPI GCANNNNNTGC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 231
BstHHI GCGC 1 cut(s) 59
BstKTI GATC 2 cut(s) 118, 131
BstMBI GATC 2 cut(s) 115, 128
BstMWI GCNNNNNNNGC 2 cut(s) 32, 71
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 244
BtsIMutI CAGTG 1 cut(s) 118
CfoI GCGC 1 cut(s) 59
CviAII CATG 1 cut(s) 162
CviJI RGCY 1 cut(s) 74
CviKI_1 RGCY 1 cut(s) 74
DdeI CTNAG 1 cut(s) 231
DpnI GATC 2 cut(s) 117, 130
DpnII GATC 2 cut(s) 115, 128
DraIII CACNNNGTG 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 244
FaeI CATG 1 cut(s) 165
FaiI YATR 6 cut(s) 6, 153, 163, 211, 225, 237
FatI CATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 179
GlaI GCGC 1 cut(s) 58
HhaI GCGC 1 cut(s) 59
Hin1II CATG 1 cut(s) 165
Hin6I GCGC 1 cut(s) 57
HinP1I GCGC 1 cut(s) 57
HinfI GANTC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 3 cut(s) 12, 98, 170
HpyF10VI GCNNNNNNNGC 2 cut(s) 32, 71
HpyF3I CTNAG 1 cut(s) 231
Hsp92II CATG 1 cut(s) 165
HspAI GCGC 1 cut(s) 57
Kzo9I GATC 2 cut(s) 115, 128
LpnPI CCDG 2 cut(s) 231, 258
MaeI CTAG 1 cut(s) 179
MalI GATC 2 cut(s) 117, 130
MboI GATC 2 cut(s) 115, 128
MluCI AATT 1 cut(s) 18
MnlI CCTC 2 cut(s) 196, 232
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
MwoI GCNNNNNNNGC 2 cut(s) 32, 71
NdeII GATC 2 cut(s) 115, 128
NlaIII CATG 1 cut(s) 165
NlaIV GGNNCC 2 cut(s) 34, 243
PfeI GAWTC 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 244
PspGI CCWGG 1 cut(s) 244
PspN4I GGNNCC 2 cut(s) 34, 243
Sau3AI GATC 2 cut(s) 115, 128
ScrFI CCNGG 1 cut(s) 246
SetI ASST 3 cut(s) 76, 152, 247
SgeI CNNG 7 cut(s) 25, 35, 174, 179, 191, 257, 258
Sse9I AATT 1 cut(s) 18
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 244
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 18
TfiI GAWTC 1 cut(s) 157
TscAI CASTG 1 cut(s) 118
TspRI CASTG 1 cut(s) 118
XapI RAATTY 1 cut(s) 18
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.