Rmu_sc0016457.1_g000001

Oxidation resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016457.1
OG0001099
Physical Location & Seq
Forward (+)
1 .. 709
709 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016457.1_g000001.1.cds

Sequence Viewer

Length: 257 bp
gtgccaaccgctatttcacattgtgcgctactgactttttagctattggtgggggtggtcattttgcactctatttgagtagtgatctattgagtggatcaagttcagtttcagaaacctatgggaatccatgtcttgcaaactcagaagactttggtgtgaaagaagtagagttatggggttttgtgtatgctactaagtatgaggaagtacttgctcaaagtcgtatggaggcacctgggatttgccgatggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TLD

Protein Analysis

84

Amino Acids

9.17

Weight (kDa)

4.53

Isoelectric Point (pI)

44.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 234
AciI CCGC 1 cut(s) 9
AclWI GGATC 1 cut(s) 105
AdeI CACNNNGTG 1 cut(s) 23
AfaI GTAC 1 cut(s) 212
AjnI CCWGG 1 cut(s) 237
AjuI GAANNNNNNNTTGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AlwI GGATC 1 cut(s) 105
AspLEI GCGC 1 cut(s) 28
BanI GGYRCC 1 cut(s) 234
BbsI GAAGAC 1 cut(s) 155
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 1 cut(s) 239
BmcAI AGTACT 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 239
BmiI GGNNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 239
BpiI GAAGAC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 238
BseBI CCWGG 1 cut(s) 239
BseDI CCNNGG 1 cut(s) 238
BseMII CTCAG 1 cut(s) 158
BshNI GGYRCC 1 cut(s) 234
Bsp143I GATC 2 cut(s) 84, 97
BspACI CCGC 1 cut(s) 9
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 236
BspPI GGATC 1 cut(s) 105
BspT107I GGYRCC 1 cut(s) 234
BssECI CCNNGG 1 cut(s) 238
BssMI GATC 2 cut(s) 84, 97
Bst2UI CCWGG 1 cut(s) 239
BstDEI CTNAG 2 cut(s) 144, 197
BstHHI GCGC 1 cut(s) 28
BstKTI GATC 2 cut(s) 87, 100
BstMBI GATC 2 cut(s) 84, 97
BstNI CCWGG 1 cut(s) 239
BstSCI CCNGG 1 cut(s) 237
BstV2I GAAGAC 1 cut(s) 155
CfoI GCGC 1 cut(s) 28
Csp6I GTAC 1 cut(s) 211
CviAII CATG 1 cut(s) 131
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 2 cut(s) 144, 197
DpnI GATC 2 cut(s) 86, 99
DpnII GATC 2 cut(s) 84, 97
DraIII CACNNNGTG 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 237
FaeI CATG 1 cut(s) 134
FaiI YATR 6 cut(s) 122, 132, 177, 191, 203, 229
FatI CATG 1 cut(s) 130
GlaI GCGC 1 cut(s) 27
HhaI GCGC 1 cut(s) 28
Hin1II CATG 1 cut(s) 134
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HinfI GANTC 1 cut(s) 126
Hpy188I TCNGA 2 cut(s) 114, 147
HpyCH4V TGCA 2 cut(s) 67, 139
HpyF3I CTNAG 2 cut(s) 144, 197
Hsp92II CATG 1 cut(s) 134
HspAI GCGC 1 cut(s) 26
Kzo9I GATC 2 cut(s) 84, 97
LpnPI CCDG 2 cut(s) 224, 251
MalI GATC 2 cut(s) 86, 99
MboI GATC 2 cut(s) 84, 97
MboII GAAGA 1 cut(s) 160
MnlI CCTC 2 cut(s) 198, 225
MspR9I CCNGG 1 cut(s) 239
MvaI CCWGG 1 cut(s) 239
NdeII GATC 2 cut(s) 84, 97
NlaIII CATG 1 cut(s) 134
NlaIV GGNNCC 1 cut(s) 236
PfeI GAWTC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 237
PspGI CCWGG 1 cut(s) 237
PspN4I GGNNCC 1 cut(s) 236
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
Sau3AI GATC 2 cut(s) 84, 97
ScaI AGTACT 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 239
SetI ASST 3 cut(s) 45, 121, 240
SgeI CNNG 6 cut(s) 113, 143, 148, 226, 250, 251
SsiI CCGC 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 237
TatI WGTACW 1 cut(s) 210
TfiI GAWTC 1 cut(s) 126
ZrmI AGTACT 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.