Rh2DG251700

Oxidation resistance protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
26078213 .. 26078665
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG251700.1

Sequence Viewer

Length: 162 bp
ATGCTTTGGCCTGGCCTCAGTTTACTGGTTGTTGGAGACCGTAAAGGTGCAGTTTTTGGTTGCTTGGTGGAGGCACCTCTAAGACCCACAAACAAGAAGTATCAGGTCCTGCTGAAGCAAACACATCCTATGAATCCATCTAGCAATTATTTCCTTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.94

Weight (kDa)

9.74

Isoelectric Point (pI)

30.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 160
AccB1I GGYRCC 1 cut(s) 73
AcuI CTGAAG 1 cut(s) 134
AjnI CCWGG 1 cut(s) 10
Alw26I GTCTC 1 cut(s) 30
AlwNI CAGNNNCTG 1 cut(s) 109
AoxI GGCC 2 cut(s) 8, 13
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BanI GGYRCC 1 cut(s) 73
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 12
BcoDI GTCTC 1 cut(s) 30
BfaI CTAG 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 12
BsaI GGTCTC 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 12
BseGI GGATG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 31
BseNI ACTGG 1 cut(s) 30
BsgI GTGCAG 1 cut(s) 69
BshFI GGCC 2 cut(s) 10, 15
BshNI GGYRCC 1 cut(s) 73
BsmAI GTCTC 1 cut(s) 30
BsnI GGCC 2 cut(s) 10, 15
Bso31I GGTCTC 1 cut(s) 30
BspANI GGCC 2 cut(s) 10, 15
BspCNI CTCAG 1 cut(s) 30
BspLI GGNNCC 1 cut(s) 75
BspT107I GGYRCC 1 cut(s) 73
BspTNI GGTCTC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 12
Bst4CI ACNGT 1 cut(s) 41
BstDEI CTNAG 2 cut(s) 17, 80
BstF5I GGATG 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BsuRI GGCC 2 cut(s) 10, 15
BtsCI GGATG 1 cut(s) 124
CaiI CAGNNNCTG 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 106
CviJI RGCY 2 cut(s) 10, 15
CviKI_1 RGCY 2 cut(s) 10, 15
DdeI CTNAG 2 cut(s) 17, 80
Eco31I GGTCTC 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 134
EcoO109I RGGNCCY 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 10
FaiI YATR 2 cut(s) 131, 160
FokI GGATG 1 cut(s) 111
FspBI CTAG 1 cut(s) 141
HaeIII GGCC 2 cut(s) 10, 15
HinfI GANTC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 1 cut(s) 50
HpyF3I CTNAG 2 cut(s) 17, 80
LpnPI CCDG 4 cut(s) 11, 24, 89, 122
MaeI CTAG 1 cut(s) 141
MluCI AATT 1 cut(s) 145
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 3 cut(s) 26, 64, 87
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
NlaIV GGNNCC 1 cut(s) 75
PfeI GAWTC 1 cut(s) 133
PpuMI RGGWCCY 1 cut(s) 106
PsiI TTATAA 1 cut(s) 160
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PstNI CAGNNNCTG 1 cut(s) 109
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 12
SetI ASST 3 cut(s) 49, 79, 108
SgeI CNNG 8 cut(s) 23, 24, 38, 76, 106, 116, 121, 153
SinI GGWCC 1 cut(s) 106
Sse9I AATT 1 cut(s) 145
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 41
TasI AATT 1 cut(s) 145
TfiI GAWTC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 106
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.