Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0000596

Physical Location & Seq

Genomic Coordinates Reverse (-)

47980146 .. 47980334

Gene Structure 189 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ50297

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGTTGTTGCTGGACATCCCATGCTCTTATTGGAAAAGGACTACTTCATTTTGATTAGCACCGGTCTTGGTGCAATTTTTGGAGTATTTCAATTGATAATTTATGCAATATACTACAGAACTACACCAAAAGACGAAGACCTCTCTGGGAAGACTACTAATGACGTGCAACTTTGTACTAATGTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006810 GO:0008150 GO:0008643 GO:0015144 GO:0016020 GO:0016021 GO:0022857 GO:0031224 GO:0031226 GO:0034219 GO:0044425 GO:0044459 GO:0044464 GO:0051119 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MtN3_slv

Protein Analysis

62

Amino Acids

6.91

Weight (kDa)

4.89

Isoelectric Point (pI)

13.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000596)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G40260 AT5G40260
fragaria_vesca	FvH4_4g13312 FvH4_6g50390 FvH4_6g50390 FvH4_6g50580 FvH4_7g10730
malus_domestica	MD17G1035200.v1.1
prunus_persica	Prupe.3G283400_v2.0.a1
pyrus_communis	pycom17g03250
rosa_chinensis	RchiOBHm_Chr1g0349441 RchiOBHm_Chr1g0359391 RchiOBHm_Chr1g0359411 RchiOBHm_Chr1g0359541 RchiOBHm_Chr1g0359551 RchiOBHm_Chr1g0360181 RchiOBHm_Chr2g0131641 RchiOBHm_Chr2g0171121 RchiOBHm_Chr4g0413611 RchiOBHm_Chr5g0028121 RchiOBHm_Chr5g0037121 RchiOBHm_Chr5g0083341 RchiOBHm_Chr7g0239371
rosa_laevigata	RLG00000008206 RLG00000022004 RLG00000027823 RLG00000027873 RLG00000028548 RLG00000037029
rosa_multiflora	Rmu_sc0001287.1_g000004 Rmu_sc0001444.1_g000014 Rmu_sc0002245.1_g000046 Rmu_sc0002495.1_g000008 Rmu_sc0025358.1_g000001 Rmu_ssc0000358.1_g000004 Rmu_ssc0000358.1_g000005 Rmu_ssc0000368.1_g000047
rosa_roxburghii	Rroxscaffold_2G00080810 Rroxscaffold_4G00296320 Rroxscaffold_5G00357560
rosa_rugosa	Rorug01G0203900 Rorug01G0270900 Rorug01G0271000 Rorug01G0272100 Rorug01G0275700 Rorug02G0553600 Rorug04G0121500 Rorug04G0121600 Rorug05G0104200 Rorug05G0104300 Rorug05G0484300
rosa_samantha	Rh1AG221100 Rh1AG284300 Rh1AG284400 Rh1AG289400 Rh1CG206000 Rh1CG272400 Rh1DG216500 Rh1DG279300 Rh1DG279400 Rh1DG284500 Rh2AG627300 Rh2BG637200 Rh2DG648800 Rh2DG654400 Rh4CG192300 Rh4DG176500 Rh5AG533700 Rh5BG561400 Rh5DG570300 Rh7CG498900 Rh7DG467000
rosa_wichuraiana	Rw1G018790 Rw1G025240 Rw1G025250 Rw1G025680 Rw2G028530 Rw2G051920 Rw4G015140 Rw5G049910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	178
AgeI	ACCGGT	1 cut(s)	62
AgsI	TTSAA	1 cut(s)	92
AjiI	CACGTC	1 cut(s)	166
AsiGI	ACCGGT	1 cut(s)	62
BbsI	GAAGAC	2 cut(s)	144, 158
BfmI	CTRYAG	1 cut(s)	115
BmgBI	CACGTC	1 cut(s)	166
BpiI	GAAGAC	2 cut(s)	144, 158
BsaWI	WCCGGW	1 cut(s)	62
Bse118I	RCCGGY	1 cut(s)	62
BseGI	GGATG	1 cut(s)	16
BshTI	ACCGGT	1 cut(s)	62
BsiSI	CCGG	1 cut(s)	63
BsrFI	RCCGGY	1 cut(s)	62
BssAI	RCCGGY	1 cut(s)	62
BstF5I	GGATG	1 cut(s)	16
BstSFI	CTRYAG	1 cut(s)	115
BstV2I	GAAGAC	2 cut(s)	144, 158
BtrI	CACGTC	1 cut(s)	166
BtsCI	GGATG	1 cut(s)	16
Cfr10I	RCCGGY	1 cut(s)	62
Csp6I	GTAC	1 cut(s)	177
CspAI	ACCGGT	1 cut(s)	62
CviAII	CATG	1 cut(s)	22
CviQI	GTAC	1 cut(s)	177
FaeI	CATG	1 cut(s)	25
FaiI	YATR	3 cut(s)	23, 105, 112
FalI	AAGNNNNNCTT	2 cut(s)	29, 61
FatI	CATG	1 cut(s)	21
FokI	GGATG	1 cut(s)	3
HapII	CCGG	1 cut(s)	63
Hin1II	CATG	1 cut(s)	25
HpaII	CCGG	1 cut(s)	63
HpyCH4IV	ACGT	1 cut(s)	165
HpyCH4V	TGCA	3 cut(s)	74, 107, 169
HpySE526I	ACGT	1 cut(s)	165
Hsp92II	CATG	1 cut(s)	25
LpnPI	CCDG	2 cut(s)	76, 132
MaeII	ACGT	1 cut(s)	165
MboII	GAAGA	2 cut(s)	149, 163
MfeI	CAATTG	1 cut(s)	92
MluCI	AATT	3 cut(s)	75, 92, 99
MnlI	CCTC	1 cut(s)	152
MspI	CCGG	1 cut(s)	63
MunI	CAATTG	1 cut(s)	92
NlaIII	CATG	1 cut(s)	25
PinAI	ACCGGT	1 cut(s)	62
RsaI	GTAC	1 cut(s)	178
RsaNI	GTAC	1 cut(s)	177
SetI	ASST	2 cut(s)	144, 168
SfcI	CTRYAG	1 cut(s)	115
SgeI	CNNG	6 cut(s)	24, 34, 75, 80, 159, 178
Sse9I	AATT	3 cut(s)	75, 92, 99
TaiI	ACGT	1 cut(s)	168
TasI	AATT	3 cut(s)	75, 92, 99
TatI	WGTACW	1 cut(s)	176
TspDTI	ATGAA	1 cut(s)	37
XcmI	CCANNNNNNNNNTGG	1 cut(s)	28

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.