RchiOBHm_Chr3g0471841

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000962
Physical Location & Seq
Forward (+)
17685541 .. 17685791
251 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43758

Sequence Viewer

Length: 168 bp
ATGCTTGCTGAGGATGCCATCAAGGCAGCTGTTAAAGACTATCAAACAAAGCTGGCTAATGAAGGATTGCTTATCATCTTTGCCTACAAGAGAGCTTCTGCAAGAGCAAATGAAGGTGCATTAAAGGAAAGCAGTAGTAATCTATGTAGTTTAGGTCTTCCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

5.84

Weight (kDa)

7.87

Isoelectric Point (pI)

30.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 4 cut(s) 29, 52, 95, 165
AluI AGCT 4 cut(s) 29, 52, 95, 165
ApeKI GCWGC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 149
BbvCI CCTCAGC 1 cut(s) 9
BbvI GCAGC 1 cut(s) 38
BccI CCATC 1 cut(s) 26
BfaI CTAG 2 cut(s) 162, 166
BglI GCCNNNNNGGC 1 cut(s) 23
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
BmsI GCATC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 149
Bpu10I CCTNAGC 1 cut(s) 9
BseGI GGATG 1 cut(s) 19
BseXI GCAGC 1 cut(s) 38
BstC8I GCNNGC 2 cut(s) 6, 54
BstDEI CTNAG 1 cut(s) 9
BstF5I GGATG 1 cut(s) 19
BstMWI GCNNNNNNNGC 2 cut(s) 14, 23
BstV1I GCAGC 1 cut(s) 38
BstV2I GAAGAC 1 cut(s) 149
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 2 cut(s) 6, 54
CviJI RGCY 5 cut(s) 29, 52, 56, 95, 165
CviKI_1 RGCY 5 cut(s) 29, 52, 56, 95, 165
DdeI CTNAG 1 cut(s) 9
FaiI YATR 1 cut(s) 145
FalI AAGNNNNNCTT 2 cut(s) 54, 86
Fnu4HI GCNGC 1 cut(s) 27
FokI GGATG 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 27
FspBI CTAG 2 cut(s) 162, 166
FspEI CC 8 cut(s) 8, 31, 38, 48, 97, 99, 110, 138
GluI GCNGC 1 cut(s) 27
HpyAV CCTTC 2 cut(s) 56, 107
HpyCH4V TGCA 2 cut(s) 101, 119
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 23
HpyF3I CTNAG 1 cut(s) 9
LpnPI CCDG 1 cut(s) 38
Lsp1109I GCAGC 1 cut(s) 38
LweI GCATC 1 cut(s) 4
MaeI CTAG 2 cut(s) 162, 166
MboII GAAGA 1 cut(s) 149
MnlI CCTC 1 cut(s) 4
MseI TTAA 2 cut(s) 33, 122
MspA1I CMGCKG 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 14, 23
PkrI GCNGC 1 cut(s) 28
PvuII CAGCTG 1 cut(s) 29
SaqAI TTAA 2 cut(s) 33, 122
SatI GCNGC 1 cut(s) 27
SetI ASST 6 cut(s) 31, 54, 97, 118, 157, 167
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 5 cut(s) 17, 34, 65, 100, 114
SspMI CTAG 2 cut(s) 162, 166
Tru1I TTAA 2 cut(s) 33, 122
Tru9I TTAA 2 cut(s) 33, 122
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 2 cut(s) 75, 126
XspI CTAG 2 cut(s) 162, 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.