Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7D

Orthogroup ID

OG0000962

Physical Location & Seq

Genomic Coordinates Forward (+)

43691336 .. 43693845

Gene Structure 2510 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7DG335700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGGTACAAGAGGCTTGAAGTTTTGTCAGCTTTTACCAATGCTGGTGGTGTTGATGTCTGCAACTGCTGATATTGGAAGGTACAGGGATTACTTTAAAGATCATGGCGGGGATGAATGGGTGGAAGTGCTTGCAATCCCTAACTCTGGCCAGAAAATCATTTTTTCAGAAAAGGGTTTCTTATCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003724 GO:0003729 GO:0003824 GO:0004004 GO:0004386 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0006139 GO:0006396 GO:0006725 GO:0006807 GO:0008026 GO:0008150 GO:0008152 GO:0008186 GO:0009507 GO:0009536 GO:0009987 GO:0010467 GO:0016070 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0031974 GO:0031981 GO:0034641 GO:0042623 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0070013 GO:0070035 GO:0071704 GO:0090304 GO:0097159 GO:0140098 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DEAD Helicase_C zf-CCCH

Protein Analysis

62

Amino Acids

6.95

Weight (kDa)

6.53

Isoelectric Point (pI)

2.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000962)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10930
fragaria_vesca	FvH4_5g28920 FvH4_5g28920
malus_domestica	MD02G1262900.v1.1 MD07G1056800.v1.1 MD07G1057400.v1.1
prunus_persica	Prupe.4G271400_v2.0.a1 Prupe.4G271400_v2.0.a1 Prupe.4G271400_v2.0.a1 Prupe.4G271400_v2.0.a1 Prupe.4G271400_v2.0.a1
pyrus_communis	pycom02g22480 pycom02g22490 pycom02g22530 pycom07g04380
rosa_chinensis	RchiOBHm_Chr2g0101731 RchiOBHm_Chr2g0146651 RchiOBHm_Chr3g0471841 RchiOBHm_Chr4g0402091 RchiOBHm_Chr5g0019321 RchiOBHm_Chr7g0221231
rosa_laevigata	RLG00000002168 RLG00000008436
rosa_multiflora	Rmu_co8338979.1_g000001 Rmu_co8389917.1_g000001 Rmu_sc0000212.1_g000013 Rmu_sc0000324.1_g000016 Rmu_sc0000518.1_g000001 Rmu_sc0000808.1_g000043 Rmu_sc0002206.1_g000018 Rmu_sc0002551.1_g000024 Rmu_sc0004296.1_g000023 Rmu_sc0009806.1_g000017 Rmu_sc0032411.1_g000001 Rmu_ssc0000291.1_g000025
rosa_roxburghii	Rroxscaffold_176G00431210 Rroxscaffold_1G00026280 Rroxscaffold_3G00238540 Rroxscaffold_4G00313160 Rroxscaffold_4G00330040 Rroxscaffold_5G00342230 Rroxscaffold_5G00352050
rosa_rugosa	Rorug07G0201600 Rorug07G0253300
rosa_samantha	Rh1BG131100 Rh1CG101400 Rh2BG215600 Rh2CG271000 Rh4DG065200 Rh4DG134600 Rh5AG275200 Rh5AG434000 Rh7AG340500 Rh7BG172400 Rh7BG331600 Rh7BG331700 Rh7CG358400 Rh7DG335700 Rh7DG335800 Rh7DG339200 Rh7DG339300
rosa_wichuraiana	Rw6G023870 Rw7G028980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	108
AcoI	YGGCCR	1 cut(s)	148
AfaI	GTAC	2 cut(s)	7, 83
AfiI	CCNNNNNNNGG	1 cut(s)	146
AgsI	TTSAA	1 cut(s)	19
AluBI	AGCT	1 cut(s)	31
AluI	AGCT	1 cut(s)	31
AoxI	GGCC	1 cut(s)	148
BalI	TGGCCA	1 cut(s)	150
Bsc4I	CCNNNNNNNGG	1 cut(s)	146
BseGI	GGATG	1 cut(s)	118
BseLI	CCNNNNNNNGG	1 cut(s)	146
BshFI	GGCC	1 cut(s)	150
BslI	CCNNNNNNNGG	1 cut(s)	146
BsnI	GGCC	1 cut(s)	150
Bsp143I	GATC	1 cut(s)	100
BspACI	CCGC	1 cut(s)	108
BspANI	GGCC	1 cut(s)	150
BssMI	GATC	1 cut(s)	100
BstC8I	GCNNGC	1 cut(s)	132
BstF5I	GGATG	1 cut(s)	118
BstKTI	GATC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	100
BsuRI	GGCC	1 cut(s)	150
BtsCI	GGATG	1 cut(s)	118
Cac8I	GCNNGC	1 cut(s)	132
Csp6I	GTAC	2 cut(s)	6, 82
CspCI	CAANNNNNGTGG	2 cut(s)	27, 62
CviAII	CATG	1 cut(s)	104
CviJI	RGCY	3 cut(s)	15, 31, 150
CviKI_1	RGCY	3 cut(s)	15, 31, 150
CviQI	GTAC	2 cut(s)	6, 82
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
DraI	TTTAAA	1 cut(s)	97
EaeI	YGGCCR	1 cut(s)	148
FaeI	CATG	1 cut(s)	107
FaiI	YATR	1 cut(s)	105
FalI	AAGNNNNNCTT	1 cut(s)	164
FatI	CATG	1 cut(s)	103
FauI	CCCGC	1 cut(s)	101
FokI	GGATG	1 cut(s)	125
HaeIII	GGCC	1 cut(s)	150
Hin1II	CATG	1 cut(s)	107
Hpy188I	TCNGA	1 cut(s)	169
Hpy188III	TCNNGA	1 cut(s)	186
HpyAV	CCTTC	1 cut(s)	72
HpyCH4V	TGCA	2 cut(s)	62, 134
Hsp92II	CATG	1 cut(s)	107
Kzo9I	GATC	1 cut(s)	100
LpnPI	CCDG	4 cut(s)	29, 70, 132, 164
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MlsI	TGGCCA	1 cut(s)	150
MluNI	TGGCCA	1 cut(s)	150
MnlI	CCTC	1 cut(s)	5
Mox20I	TGGCCA	1 cut(s)	150
MscI	TGGCCA	1 cut(s)	150
MseI	TTAA	1 cut(s)	96
Msp20I	TGGCCA	1 cut(s)	150
NdeII	GATC	1 cut(s)	100
NlaIII	CATG	1 cut(s)	107
RsaI	GTAC	2 cut(s)	7, 83
RsaNI	GTAC	2 cut(s)	6, 82
SaqAI	TTAA	1 cut(s)	96
Sau3AI	GATC	1 cut(s)	100
SetI	ASST	2 cut(s)	33, 83
SgeI	CNNG	9 cut(s)	21, 28, 56, 97, 116, 121, 143, 159, 163
SsiI	CCGC	1 cut(s)	108
Tru1I	TTAA	1 cut(s)	96
Tru9I	TTAA	1 cut(s)	96
TspDTI	ATGAA	1 cut(s)	129

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.