Rmu_co8107114.1_g000001

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8107114.1
Physical Location & Seq
Forward (+)
81 .. 434
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8107114.1_g000001.1.cds

Sequence Viewer

Length: 354 bp
atgggtcttcgtcttcctctatcagaatgcaactccggcgccagcagagtgctatactcgaagcccgttctcttcaagcaacccttcacttcgttttctgctagcttctccacattcttcacgttctccgtcagcaatttgaacccctcctcgatcggtggcaggctggcttttatcatctcgcctgacgatgaggttgtcaaagacgctggcgggttcttggggcctcagagtgtggaggacccaagtttgggttccgggtcgagcttcatggtggtggacctcgtaaattgctggatcgaattcggcgggtctgcaacatatccgtttcgtattcgaacctcaaacccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

12.54

Weight (kDa)

5.17

Isoelectric Point (pI)

52.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 38
AciI CCGC 2 cut(s) 213, 309
AclWI GGATC 1 cut(s) 305
AcsI RAATTY 1 cut(s) 302
AcyI GRCGYC 1 cut(s) 39
AfiI CCNNNNNNNGG 2 cut(s) 250, 251
AgsI TTSAA 2 cut(s) 76, 142
AjuI GAANNNNNNNTTGG 2 cut(s) 238, 270
AluBI AGCT 2 cut(s) 105, 267
AluI AGCT 2 cut(s) 105, 267
AlwI GGATC 1 cut(s) 305
AoxI GGCC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 302
AspLEI GCGC 1 cut(s) 41
AspS9I GGNCC 3 cut(s) 224, 241, 280
AsuC2I CCSGG 1 cut(s) 259
AsuII TTCGAA 1 cut(s) 337
AsuNHI GCTAGC 1 cut(s) 101
AvaII GGWCC 2 cut(s) 241, 280
BanI GGYRCC 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 5
BcnI CCSGG 1 cut(s) 259
BfaI CTAG 1 cut(s) 102
BfoI RGCGCY 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 259
Bme18I GGWCC 2 cut(s) 241, 280
BmgT120I GGNCC 3 cut(s) 224, 241, 280
BmiI GGNNCC 4 cut(s) 40, 225, 243, 256
BmrFI CCNGG 1 cut(s) 259
BmtI GCTAGC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 5
Bpu14I TTCGAA 1 cut(s) 337
BpuMI CCSGG 1 cut(s) 259
BsaHI GRCGYC 1 cut(s) 39
Bsc4I CCNNNNNNNGG 2 cut(s) 250, 251
BseLI CCNNNNNNNGG 2 cut(s) 250, 251
BseMII CTCAG 1 cut(s) 242
BseRI GAGGAG 1 cut(s) 139
Bsh1285I CGRYCG 1 cut(s) 156
BshFI GGCC 1 cut(s) 226
BshNI GGYRCC 1 cut(s) 38
BsiEI CGRYCG 1 cut(s) 156
BsiSI CCGG 2 cut(s) 36, 258
BslI CCNNNNNNNGG 2 cut(s) 250, 251
BsmI GAATGC 1 cut(s) 32
BsnI GGCC 1 cut(s) 226
Bsp119I TTCGAA 1 cut(s) 337
Bsp143I GATC 2 cut(s) 153, 297
BspACI CCGC 2 cut(s) 213, 309
BspANI GGCC 1 cut(s) 226
BspCNI CTCAG 1 cut(s) 241
BspLI GGNNCC 4 cut(s) 40, 225, 243, 256
BspOI GCTAGC 1 cut(s) 105
BspPI GGATC 1 cut(s) 305
BspT104I TTCGAA 1 cut(s) 337
BspT107I GGYRCC 1 cut(s) 38
BssMI GATC 2 cut(s) 153, 297
BssNI GRCGYC 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 77
BstACI GRCGYC 1 cut(s) 39
BstBI TTCGAA 1 cut(s) 337
BstC8I GCNNGC 5 cut(s) 43, 103, 164, 168, 211
BstDEI CTNAG 1 cut(s) 228
BstH2I RGCGCY 1 cut(s) 42
BstHHI GCGC 1 cut(s) 41
BstKTI GATC 2 cut(s) 156, 300
BstMBI GATC 2 cut(s) 153, 297
BstMCI CGRYCG 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 257
BstV2I GAAGAC 1 cut(s) 5
BsuRI GGCC 1 cut(s) 226
Cac8I GCNNGC 5 cut(s) 43, 103, 164, 168, 211
CfoI GCGC 1 cut(s) 41
Cfr13I GGNCC 3 cut(s) 224, 241, 280
CseI GACGC 1 cut(s) 215
CviAII CATG 1 cut(s) 271
CviJI RGCY 6 cut(s) 64, 105, 166, 170, 226, 267
CviKI_1 RGCY 6 cut(s) 64, 105, 166, 170, 226, 267
DdeI CTNAG 1 cut(s) 228
DinI GGCGCC 1 cut(s) 40
DpnI GATC 2 cut(s) 155, 299
DpnII GATC 2 cut(s) 153, 297
Eam1104I CTCTTC 1 cut(s) 77
EarI CTCTTC 1 cut(s) 77
Eco47I GGWCC 2 cut(s) 241, 280
EcoO109I RGGNCCY 2 cut(s) 224, 241
EcoRI GAATTC 1 cut(s) 302
EgeI GGCGCC 1 cut(s) 40
EheI GGCGCC 1 cut(s) 40
FaeI CATG 1 cut(s) 274
FaiI YATR 4 cut(s) 55, 272, 322, 352
FalI AAGNNNNNCTT 2 cut(s) 68, 100
FatI CATG 1 cut(s) 270
FauI CCCGC 2 cut(s) 206, 302
FspBI CTAG 1 cut(s) 102
GlaI GCGC 1 cut(s) 40
HaeII RGCGCY 1 cut(s) 42
HaeIII GGCC 1 cut(s) 226
HapII CCGG 2 cut(s) 36, 258
HgaI GACGC 1 cut(s) 215
HhaI GCGC 1 cut(s) 41
Hin1I GRCGYC 1 cut(s) 39
Hin1II CATG 1 cut(s) 274
Hin6I GCGC 1 cut(s) 39
HinP1I GCGC 1 cut(s) 39
HpaII CCGG 2 cut(s) 36, 258
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 2 cut(s) 25, 231
Hpy8I GTNNAC 1 cut(s) 280
HpyAV CCTTC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 30, 317
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpyF3I CTNAG 1 cut(s) 228
HpySE526I ACGT 1 cut(s) 122
Hsp92I GRCGYC 1 cut(s) 39
Hsp92II CATG 1 cut(s) 274
HspAI GCGC 1 cut(s) 39
KasI GGCGCC 1 cut(s) 38
Kzo9I GATC 2 cut(s) 153, 297
LpnPI CCDG 8 cut(s) 49, 55, 148, 152, 195, 198, 271, 280
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 122
MalI GATC 2 cut(s) 155, 299
MboI GATC 2 cut(s) 153, 297
MboII GAAGA 3 cut(s) 5, 64, 109
MluCI AATT 3 cut(s) 136, 289, 302
Mly113I GGCGCC 1 cut(s) 39
MnlI CCTC 8 cut(s) 27, 157, 160, 187, 232, 237, 293, 352
MslI CAYNNNNRTG 1 cut(s) 275
MspI CCGG 2 cut(s) 36, 258
MspR9I CCNGG 1 cut(s) 259
Mva1269I GAATGC 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 36
NarI GGCGCC 1 cut(s) 39
NciI CCSGG 1 cut(s) 259
NdeII GATC 2 cut(s) 153, 297
NheI GCTAGC 1 cut(s) 101
NlaIII CATG 1 cut(s) 274
NlaIV GGNNCC 4 cut(s) 40, 225, 243, 256
NspV TTCGAA 1 cut(s) 337
PctI GAATGC 1 cut(s) 32
Ple19I CGATCG 1 cut(s) 156
PluTI GGCGCC 1 cut(s) 42
PpuMI RGGWCCY 1 cut(s) 241
Psp5II RGGWCCY 1 cut(s) 241
PspN4I GGNNCC 4 cut(s) 40, 225, 243, 256
PspPI GGNCC 3 cut(s) 224, 241, 280
PspPPI RGGWCCY 1 cut(s) 241
PvuI CGATCG 1 cut(s) 156
RseI CAYNNNNRTG 1 cut(s) 275
Sau3AI GATC 2 cut(s) 153, 297
Sau96I GGNCC 3 cut(s) 224, 241, 280
ScrFI CCNGG 1 cut(s) 259
SetI ASST 6 cut(s) 107, 125, 198, 269, 285, 344
SfoI GGCGCC 1 cut(s) 40
SfuI TTCGAA 1 cut(s) 337
SinI GGWCC 2 cut(s) 241, 280
SmiMI CAYNNNNRTG 1 cut(s) 275
Sse9I AATT 3 cut(s) 136, 289, 302
SsiI CCGC 2 cut(s) 213, 309
SspDI GGCGCC 1 cut(s) 38
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 257
TaiI ACGT 1 cut(s) 125
TaqI TCGA 5 cut(s) 59, 152, 263, 300, 337
TasI AATT 3 cut(s) 136, 289, 302
TspDTI ATGAA 1 cut(s) 259
TspGWI ACGGA 2 cut(s) 118, 315
VpaK11BI GGWCC 2 cut(s) 241, 280
XapI RAATTY 1 cut(s) 302
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.