Rmu_sc0010695.1_g000003

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010695.1
Physical Location & Seq
Reverse (-)
4951 .. 5541
591 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010695.1_g000003.1.cds

Sequence Viewer

Length: 513 bp
atgggtcttcgtcttcctctattagaatgcaactccggcgctggcagagtgctgtacaagaagcctgtctgcttcaagcaaccctccactccgtttccaactagcttctccacattcttcacgttctccatcagcaatttgaacccctcctcgatctgcgacgggctgacttttatcatctggccagatgatgaggttgtcggagacgccgacgagttcttggggctccaaagcgtggaggacccaggttcgggttccgggtcgagcttcgtggcggtgaacctcgtgaattgctggatccaattcggcgggtcgagtcggtacgtcaaagacttgggtgtttctgggtgtttaggatctgggttgtttatgggtgtttatgatctgggttgtgtgttgttattgctcgatctgatctgggtgtttctgatcattcgtaatatgttggatgacgatagtgaggtggcttattggtgggagtggtggaggatgaggaggaggagaggtggctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

170

Amino Acids

18.91

Weight (kDa)

4.62

Isoelectric Point (pI)

46.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 235
AciI CCGC 2 cut(s) 275, 309
AclWI GGATC 3 cut(s) 292, 305, 364
AcoI YGGCCR 1 cut(s) 182
AcyI GRCGYC 1 cut(s) 207
AfaI GTAC 2 cut(s) 56, 323
AfiI CCNNNNNNNGG 3 cut(s) 235, 250, 251
AgsI TTSAA 2 cut(s) 76, 142
AjnI CCWGG 1 cut(s) 244
AluBI AGCT 2 cut(s) 105, 267
AluI AGCT 2 cut(s) 105, 267
Alw26I GTCTC 1 cut(s) 198
AlwI GGATC 3 cut(s) 292, 305, 364
AoxI GGCC 1 cut(s) 182
AspLEI GCGC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 241
AsuC2I CCSGG 1 cut(s) 259
AsuHPI GGTGA 1 cut(s) 289
AvaII GGWCC 1 cut(s) 241
BalI TGGCCA 1 cut(s) 184
BamHI GGATCC 1 cut(s) 297
BanII GRGCYC 1 cut(s) 228
BauI CACGAG 1 cut(s) 284
BbsI GAAGAC 1 cut(s) 5
BccI CCATC 1 cut(s) 137
BciT130I CCWGG 1 cut(s) 246
BclI TGATCA 1 cut(s) 429
BcnI CCSGG 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 198
BfaI CTAG 1 cut(s) 102
BfoI RGCGCY 1 cut(s) 42
Bme1390I CCNGG 2 cut(s) 246, 259
Bme18I GGWCC 1 cut(s) 241
BmgT120I GGNCC 1 cut(s) 241
BmiI GGNNCC 4 cut(s) 227, 243, 256, 299
BmrFI CCNGG 2 cut(s) 246, 259
BpiI GAAGAC 1 cut(s) 5
BpuMI CCSGG 1 cut(s) 259
BsaHI GRCGYC 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 244
BsaXI ACNNNNNCTCC 1 cut(s) 490
Bsc4I CCNNNNNNNGG 3 cut(s) 235, 250, 251
BseBI CCWGG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 244
BseGI GGATG 2 cut(s) 454, 495
BseLI CCNNNNNNNGG 3 cut(s) 235, 250, 251
BseRI GAGGAG 3 cut(s) 139, 508, 511
BshFI GGCC 1 cut(s) 184
BsiSI CCGG 2 cut(s) 36, 258
BslI CCNNNNNNNGG 3 cut(s) 235, 250, 251
BsmAI GTCTC 1 cut(s) 198
BsmBI CGTCTC 1 cut(s) 198
BsmI GAATGC 1 cut(s) 32
BsnI GGCC 1 cut(s) 184
Bsp1286I GDGCHC 1 cut(s) 228
Bsp1407I TGTACA 1 cut(s) 54
Bsp143I GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
BspACI CCGC 2 cut(s) 275, 309
BspANI GGCC 1 cut(s) 184
BspLI GGNNCC 4 cut(s) 227, 243, 256, 299
BspPI GGATC 3 cut(s) 292, 305, 364
BsrGI TGTACA 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 244
BssMI GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
BssNI GRCGYC 1 cut(s) 207
BssSI CACGAG 1 cut(s) 284
Bst2BI CACGAG 1 cut(s) 284
Bst2UI CCWGG 1 cut(s) 246
BstACI GRCGYC 1 cut(s) 207
BstAUI TGTACA 1 cut(s) 54
BstC8I GCNNGC 1 cut(s) 43
BstF5I GGATG 2 cut(s) 454, 495
BstH2I RGCGCY 1 cut(s) 42
BstHHI GCGC 1 cut(s) 41
BstKTI GATC 7 cut(s) 156, 300, 359, 385, 412, 417, 432
BstMAI GTCTC 1 cut(s) 198
BstMBI GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 2 cut(s) 244, 257
BstV2I GAAGAC 1 cut(s) 5
BstX2I RGATCY 2 cut(s) 297, 356
BstYI RGATCY 2 cut(s) 297, 356
BsuRI GGCC 1 cut(s) 184
BtsCI GGATG 2 cut(s) 454, 495
Cac8I GCNNGC 1 cut(s) 43
CfoI GCGC 1 cut(s) 41
Cfr13I GGNCC 1 cut(s) 241
CseI GACGC 1 cut(s) 215
Csp6I GTAC 2 cut(s) 55, 322
CviJI RGCY 8 cut(s) 64, 105, 166, 184, 226, 267, 467, 510
CviKI_1 RGCY 8 cut(s) 64, 105, 166, 184, 226, 267, 467, 510
CviQI GTAC 2 cut(s) 55, 322
DpnI GATC 7 cut(s) 155, 299, 358, 384, 411, 416, 431
DpnII GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
EaeI YGGCCR 1 cut(s) 182
Eco24I GRGCYC 1 cut(s) 228
Eco47I GGWCC 1 cut(s) 241
EcoO109I RGGNCCY 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 244
EcoT38I GRGCYC 1 cut(s) 228
Esp3I CGTCTC 1 cut(s) 198
FaiI YATR 3 cut(s) 371, 381, 443
FauI CCCGC 1 cut(s) 302
FbaI TGATCA 1 cut(s) 429
FokI GGATG 2 cut(s) 461, 502
FriOI GRGCYC 1 cut(s) 228
FspBI CTAG 1 cut(s) 102
GlaI GCGC 1 cut(s) 40
HaeII RGCGCY 1 cut(s) 42
HaeIII GGCC 1 cut(s) 184
HapII CCGG 2 cut(s) 36, 258
HgaI GACGC 1 cut(s) 215
HhaI GCGC 1 cut(s) 41
Hin1I GRCGYC 1 cut(s) 207
Hin6I GCGC 1 cut(s) 39
HinP1I GCGC 1 cut(s) 39
HinfI GANTC 1 cut(s) 316
HpaII CCGG 2 cut(s) 36, 258
HphI GGTGA 1 cut(s) 289
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 3 cut(s) 203, 414, 429
Hpy188III TCNNGA 1 cut(s) 286
Hpy8I GTNNAC 1 cut(s) 280
Hpy99I CGWCG 2 cut(s) 164, 215
HpyCH4IV ACGT 2 cut(s) 122, 324
HpyCH4V TGCA 1 cut(s) 30
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpySE526I ACGT 2 cut(s) 122, 324
Hsp92I GRCGYC 1 cut(s) 207
HspAI GCGC 1 cut(s) 39
Ksp22I TGATCA 1 cut(s) 429
Kzo9I GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
LmnI GCTCC 1 cut(s) 231
MaeI CTAG 1 cut(s) 102
MaeII ACGT 2 cut(s) 122, 324
MalI GATC 7 cut(s) 155, 299, 358, 384, 411, 416, 431
MboI GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
MboII GAAGA 2 cut(s) 5, 109
MflI RGATCY 2 cut(s) 297, 356
MhlI GDGCHC 1 cut(s) 228
MlsI TGGCCA 1 cut(s) 184
MluCI AATT 3 cut(s) 136, 289, 302
MluNI TGGCCA 1 cut(s) 184
MlyI GAGTC 1 cut(s) 325
MmeI TCCRAC 3 cut(s) 122, 181, 426
Mox20I TGGCCA 1 cut(s) 184
MscI TGGCCA 1 cut(s) 184
Msp20I TGGCCA 1 cut(s) 184
MspI CCGG 2 cut(s) 36, 258
MspR9I CCNGG 2 cut(s) 246, 259
Mva1269I GAATGC 1 cut(s) 32
MvaI CCWGG 1 cut(s) 246
MwoI GCNNNNNNNGC 1 cut(s) 36
NciI CCSGG 1 cut(s) 259
NdeII GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
NlaIV GGNNCC 4 cut(s) 227, 243, 256, 299
PcsI WCGNNNNNNNCGW 1 cut(s) 207
PctI GAATGC 1 cut(s) 32
PflMI CCANNNNNTGG 1 cut(s) 235
PleI GAGTC 1 cut(s) 324
PpsI GAGTC 1 cut(s) 324
PpuMI RGGWCCY 1 cut(s) 241
Psp5II RGGWCCY 1 cut(s) 241
Psp6I CCWGG 1 cut(s) 244
PspGI CCWGG 1 cut(s) 244
PspN4I GGNNCC 4 cut(s) 227, 243, 256, 299
PspPI GGNCC 1 cut(s) 241
PspPPI RGGWCCY 1 cut(s) 241
PsuI RGATCY 2 cut(s) 297, 356
RsaI GTAC 2 cut(s) 56, 323
RsaNI GTAC 2 cut(s) 55, 322
Sau3AI GATC 7 cut(s) 153, 297, 356, 382, 409, 414, 429
Sau96I GGNCC 1 cut(s) 241
SchI GAGTC 1 cut(s) 325
ScrFI CCNGG 2 cut(s) 246, 259
SduI GDGCHC 1 cut(s) 228
SetI ASST 9 cut(s) 107, 125, 198, 250, 269, 285, 327, 465, 508
SinI GGWCC 1 cut(s) 241
Sse9I AATT 3 cut(s) 136, 289, 302
SsiI CCGC 2 cut(s) 275, 309
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 2 cut(s) 244, 257
TaiI ACGT 2 cut(s) 125, 327
TaqI TCGA 4 cut(s) 152, 263, 314, 408
TasI AATT 3 cut(s) 136, 289, 302
TatI WGTACW 1 cut(s) 54
TspGWI ACGGA 1 cut(s) 81
Van91I CCANNNNNTGG 1 cut(s) 235
VpaK11BI GGWCC 1 cut(s) 241
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.