Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002846.1

Orthogroup ID

OG0001606

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1018

Gene Structure 1018 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002846.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

gacccaggttcgggttccgggtcaagattcgtgactgtggagttcgacacacttatggacgtggagttcaaggacattaatagcaaccatgtgggcctggatctcaactccatggtttcgtcacaggttggtgatcttggcactacagatattgatctcaagatcggggacctcgtgaattgctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lectin_legB Pkinase

Protein Analysis

61

Amino Acids

6.48

Weight (kDa)

4.05

Isoelectric Point (pI)

6.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001606)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g04241 FvH4_5g31301 FvH4_7g13661
pyrus_communis	pycom13g16720
rosa_chinensis	RchiOBHm_Chr3g0471751
rosa_laevigata	RLG00000006595 RLG00000028261
rosa_multiflora	Rmu_co7968634.1_g000001 Rmu_co8107114.1_g000001 Rmu_sc0000083.1_g000028 Rmu_sc0000369.1_g000013 Rmu_sc0000657.1_g000016 Rmu_sc0002002.1_g000011 Rmu_sc0002170.1_g000050 Rmu_sc0002665.1_g000005 Rmu_sc0002674.1_g000001 Rmu_sc0002835.1_g000013 Rmu_sc0002846.1_g000001 Rmu_sc0005173.1_g000026 Rmu_sc0005385.1_g000025 Rmu_sc0005947.1_g000019 Rmu_sc0006187.1_g000008 Rmu_sc0007683.1_g000006 Rmu_sc0009698.1_g000002 Rmu_sc0010695.1_g000003 Rmu_sc0012551.1_g000002 Rmu_sc0021704.1_g000003 Rmu_sc0026176.1_g000001 Rmu_sc0034984.1_g000001 Rmu_ssc0000480.1_g000030
rosa_roxburghii	Rroxscaffold_1G00013910 Rroxscaffold_2G00090660 Rroxscaffold_4G00301690 Rroxscaffold_6G00423540 Rroxscaffold_6G00424040
rosa_rugosa	Rorug01G0237600
rosa_samantha	Rh1AG249600 Rh1BG219800 Rh1DG246800 Rh2AG102200 Rh3CG187300 Rh3CG240200 Rh3CG334000 Rh3DG178400 Rh3DG203400 Rh4BG333800 Rh4DG072900 Rh5CG492800 Rh7BG430300
rosa_wichuraiana	Rw1G021780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	108
AfiI	CCNNNNNNNGG	2 cut(s)	10, 11
AgsI	TTSAA	1 cut(s)	70
AjiI	CACGTC	1 cut(s)	61
AjnI	CCWGG	2 cut(s)	4, 96
AloI	GAACNNNNNNTCC	2 cut(s)	50, 82
AlwI	GGATC	1 cut(s)	108
AoxI	GGCC	1 cut(s)	94
AseI	ATTAAT	1 cut(s)	78
AspS9I	GGNCC	2 cut(s)	94, 169
AsuC2I	CCSGG	1 cut(s)	19
AsuHPI	GGTGA	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	169
BauI	CACGAG	1 cut(s)	173
BciT130I	CCWGG	2 cut(s)	6, 98
BcnI	CCSGG	1 cut(s)	19
BfaI	CTAG	1 cut(s)	184
BfmI	CTRYAG	1 cut(s)	144
Bme1390I	CCNGG	3 cut(s)	6, 19, 98
Bme18I	GGWCC	1 cut(s)	169
BmgBI	CACGTC	1 cut(s)	61
BmgT120I	GGNCC	2 cut(s)	94, 169
BmiI	GGNNCC	2 cut(s)	16, 170
BmrFI	CCNGG	3 cut(s)	6, 19, 98
BpuEI	CTTGAG	1 cut(s)	143
BpuMI	CCSGG	1 cut(s)	19
BsaBI	GATNNNNATC	1 cut(s)	153
BsaJI	CCNNGG	2 cut(s)	4, 111
Bsc4I	CCNNNNNNNGG	2 cut(s)	10, 11
Bse8I	GATNNNNATC	1 cut(s)	153
BseBI	CCWGG	2 cut(s)	6, 98
BseDI	CCNNGG	2 cut(s)	4, 111
BseJI	GATNNNNATC	1 cut(s)	153
BseLI	CCNNNNNNNGG	2 cut(s)	10, 11
BshFI	GGCC	1 cut(s)	96
BsiSI	CCGG	1 cut(s)	18
BslFI	GGGAC	1 cut(s)	182
BslI	CCNNNNNNNGG	2 cut(s)	10, 11
BsmFI	GGGAC	1 cut(s)	182
BsnI	GGCC	1 cut(s)	96
Bsp143I	GATC	4 cut(s)	100, 133, 154, 162
Bsp19I	CCATGG	1 cut(s)	111
BspANI	GGCC	1 cut(s)	96
BspLI	GGNNCC	2 cut(s)	16, 170
BspPI	GGATC	1 cut(s)	108
BssECI	CCNNGG	2 cut(s)	4, 111
BssMI	GATC	4 cut(s)	100, 133, 154, 162
BssSI	CACGAG	1 cut(s)	173
BssT1I	CCWWGG	1 cut(s)	111
Bst2BI	CACGAG	1 cut(s)	173
Bst2UI	CCWGG	2 cut(s)	6, 98
Bst4CI	ACNGT	1 cut(s)	37
BstDSI	CCRYGG	1 cut(s)	111
BstKTI	GATC	4 cut(s)	103, 136, 157, 165
BstMBI	GATC	4 cut(s)	100, 133, 154, 162
BstNI	CCWGG	2 cut(s)	6, 98
BstSCI	CCNGG	3 cut(s)	4, 17, 96
BstSFI	CTRYAG	1 cut(s)	144
BstX2I	RGATCY	1 cut(s)	100
BstYI	RGATCY	1 cut(s)	100
BsuRI	GGCC	1 cut(s)	96
BtgI	CCRYGG	1 cut(s)	111
BtrI	CACGTC	1 cut(s)	61
Cfr13I	GGNCC	2 cut(s)	94, 169
CviAII	CATG	2 cut(s)	89, 112
CviJI	RGCY	1 cut(s)	96
CviKI_1	RGCY	1 cut(s)	96
DpnI	GATC	4 cut(s)	102, 135, 156, 164
DpnII	GATC	4 cut(s)	100, 133, 154, 162
Eco130I	CCWWGG	1 cut(s)	111
Eco47I	GGWCC	1 cut(s)	169
EcoO109I	RGGNCCY	1 cut(s)	169
EcoRII	CCWGG	2 cut(s)	4, 96
EcoT14I	CCWWGG	1 cut(s)	111
ErhI	CCWWGG	1 cut(s)	111
FaeI	CATG	2 cut(s)	92, 115
FaiI	YATR	3 cut(s)	56, 90, 113
FaqI	GGGAC	1 cut(s)	182
FatI	CATG	2 cut(s)	88, 111
FspBI	CTAG	1 cut(s)	184
HaeIII	GGCC	1 cut(s)	96
HapII	CCGG	1 cut(s)	18
Hin1II	CATG	2 cut(s)	92, 115
HinfI	GANTC	1 cut(s)	27
HpaII	CCGG	1 cut(s)	18
HphI	GGTGA	1 cut(s)	143
Hpy188III	TCNNGA	4 cut(s)	24, 31, 160, 175
HpyCH4III	ACNGT	1 cut(s)	37
HpyCH4IV	ACGT	1 cut(s)	60
HpySE526I	ACGT	1 cut(s)	60
Hsp92II	CATG	2 cut(s)	92, 115
Kzo9I	GATC	4 cut(s)	100, 133, 154, 162
LpnPI	CCDG	5 cut(s)	18, 31, 83, 110, 110
MaeI	CTAG	1 cut(s)	184
MaeII	ACGT	1 cut(s)	60
MaeIII	GTNAC	2 cut(s)	31, 120
MalI	GATC	4 cut(s)	102, 135, 156, 164
MboI	GATC	4 cut(s)	100, 133, 154, 162
MflI	RGATCY	1 cut(s)	100
MluCI	AATT	1 cut(s)	178
MnlI	CCTC	1 cut(s)	182
MseI	TTAA	1 cut(s)	78
MslI	CAYNNNNRTG	1 cut(s)	53
MspI	CCGG	1 cut(s)	18
MspR9I	CCNGG	3 cut(s)	6, 19, 98
MvaI	CCWGG	2 cut(s)	6, 98
NciI	CCSGG	1 cut(s)	19
NcoI	CCATGG	1 cut(s)	111
NdeII	GATC	4 cut(s)	100, 133, 154, 162
NlaIII	CATG	2 cut(s)	92, 115
NlaIV	GGNNCC	2 cut(s)	16, 170
NmuCI	GTSAC	2 cut(s)	31, 120
PcsI	WCGNNNNNNNCGW	1 cut(s)	171
PfeI	GAWTC	1 cut(s)	27
PpuMI	RGGWCCY	1 cut(s)	169
PshBI	ATTAAT	1 cut(s)	78
Psp5II	RGGWCCY	1 cut(s)	169
Psp6I	CCWGG	2 cut(s)	4, 96
PspGI	CCWGG	2 cut(s)	4, 96
PspN4I	GGNNCC	2 cut(s)	16, 170
PspPI	GGNCC	2 cut(s)	94, 169
PspPPI	RGGWCCY	1 cut(s)	169
PsuI	RGATCY	1 cut(s)	100
RseI	CAYNNNNRTG	1 cut(s)	53
SaqAI	TTAA	1 cut(s)	78
Sau3AI	GATC	4 cut(s)	100, 133, 154, 162
Sau96I	GGNCC	2 cut(s)	94, 169
ScrFI	CCNGG	3 cut(s)	6, 19, 98
SetI	ASST	4 cut(s)	10, 63, 129, 174
SfcI	CTRYAG	1 cut(s)	144
SinI	GGWCC	1 cut(s)	169
SmiMI	CAYNNNNRTG	1 cut(s)	53
SmlI	CTYRAG	1 cut(s)	158
SmoI	CTYRAG	1 cut(s)	158
Sse9I	AATT	1 cut(s)	178
SspMI	CTAG	1 cut(s)	184
StyD4I	CCNGG	3 cut(s)	4, 17, 96
StyI	CCWWGG	1 cut(s)	111
TaaI	ACNGT	1 cut(s)	37
TaiI	ACGT	1 cut(s)	63
TaqI	TCGA	1 cut(s)	45
TasI	AATT	1 cut(s)	178
TfiI	GAWTC	1 cut(s)	27
Tru1I	TTAA	1 cut(s)	78
Tru9I	TTAA	1 cut(s)	78
TseFI	GTSAC	2 cut(s)	31, 120
Tsp45I	GTSAC	2 cut(s)	31, 120
VpaK11BI	GGWCC	1 cut(s)	169
VspI	ATTAAT	1 cut(s)	78
XspI	CTAG	1 cut(s)	184

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.