Rmu_sc0002002.1_g000011

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002002.1
Physical Location & Seq
Forward (+)
26055 .. 28221
2167 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002002.1_g000011.1.cds

Sequence Viewer

Length: 693 bp
atgccagagaaaccaaagcgacgagtgatcgatcttgtcctcatcaccctcagcagcctcaagctcctcggcgacacccacttgaataatggcagcgtgcgtctcactcacgaccttgccgtccccaactccagcgccggcagagtgctgtactcgaagcccgtcctctttaagcaaccctccactccgtttccggccaccttttccacattcttcacattctccgtcagcaatttgaacccctcctcgatcggtagcgggctggcttttatcatctcgccggatgatgaggttgtcagagacgctggcgggttcttggggctccagagcgtggaggacccgggttcgggttccgggtcgagcttcatggaggtggagttcgacacgctcatggacgtggagttcaaggacattaatagcaaccatgtgggcctagatctcaactccatggtttcatcacaggtcggcgatcttggcgctgcggatattgatctcaagagcagggacctcgtgaattgctggatcgaattcggcaggtcgagtcgggagaaagaaagtgatgatcggaagcagggtcaactgacggtgtcttctaacattacaagattgcctatcggaggaggagaggtggctgagcttagtggggatgatgacggaggtggagatggaattgttgcggcggagcttccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

24.46

Weight (kDa)

4.51

Isoelectric Point (pI)

45.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 119
Acc36I ACCTGC 1 cut(s) 525
AccB7I CCANNNNNTGG 1 cut(s) 331
AciI CCGC 5 cut(s) 258, 309, 482, 677, 680
AclWI GGATC 1 cut(s) 530
AcoI YGGCCR 1 cut(s) 195
AcsI RAATTY 1 cut(s) 527
AfaI GTAC 1 cut(s) 152
AfiI CCNNNNNNNGG 4 cut(s) 331, 346, 347, 617
AgsI TTSAA 3 cut(s) 85, 238, 406
AjiI CACGTC 1 cut(s) 397
AloI GAACNNNNNNTCC 4 cut(s) 362, 386, 394, 418
AluBI AGCT 4 cut(s) 64, 363, 637, 685
AluI AGCT 4 cut(s) 64, 363, 637, 685
Alw26I GTCTC 2 cut(s) 107, 294
AlwI GGATC 1 cut(s) 530
Ama87I CYCGRG 1 cut(s) 340
AoxI GGCC 2 cut(s) 195, 430
ApeKI GCWGC 3 cut(s) 54, 93, 479
ApoI RAATTY 1 cut(s) 527
AseI ATTAAT 1 cut(s) 414
AspLEI GCGC 2 cut(s) 137, 479
AspS9I GGNCC 3 cut(s) 337, 430, 505
AsuC2I CCSGG 3 cut(s) 341, 342, 355
AsuHPI GGTGA 1 cut(s) 37
AvaI CYCGRG 1 cut(s) 340
AvaII GGWCC 2 cut(s) 337, 505
BanII GRGCYC 1 cut(s) 324
BauI CACGAG 1 cut(s) 509
BbsI GAAGAC 1 cut(s) 582
BbvCI CCTCAGC 1 cut(s) 50
BbvI GCAGC 3 cut(s) 66, 105, 466
BccI CCATC 1 cut(s) 659
BceAI ACGGC 1 cut(s) 104
BcgI CGANNNNNNTGC 2 cut(s) 490, 524
BcnI CCSGG 3 cut(s) 341, 342, 355
BcoDI GTCTC 2 cut(s) 107, 294
BfaI CTAG 1 cut(s) 434
BfoI RGCGCY 2 cut(s) 138, 480
BfuAI ACCTGC 1 cut(s) 525
BglII AGATCT 1 cut(s) 436
BisI GCNGC 4 cut(s) 55, 94, 480, 678
BlpI GCTNAGC 1 cut(s) 633
BlsI GCNGC 4 cut(s) 56, 95, 481, 679
Bme1390I CCNGG 3 cut(s) 341, 342, 355
Bme18I GGWCC 2 cut(s) 337, 505
BmeT110I CYCGRG 1 cut(s) 340
BmgBI CACGTC 1 cut(s) 397
BmgT120I GGNCC 3 cut(s) 337, 430, 505
BmiI GGNNCC 4 cut(s) 323, 339, 352, 506
BmrFI CCNGG 3 cut(s) 341, 342, 355
BpiI GAAGAC 1 cut(s) 582
BpmI CTGGAG 2 cut(s) 115, 308
Bpu10I CCTNAGC 1 cut(s) 50
Bpu1102I GCTNAGC 1 cut(s) 633
BpuEI CTTGAG 2 cut(s) 44, 479
BpuMI CCSGG 3 cut(s) 341, 342, 355
Bsa29I ATCGAT 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 489
BsaJI CCNNGG 3 cut(s) 67, 340, 447
BsaXI ACNNNNNCTCC 4 cut(s) 362, 392, 612, 642
Bsc4I CCNNNNNNNGG 4 cut(s) 331, 346, 347, 617
Bse118I RCCGGY 1 cut(s) 137
Bse8I GATNNNNATC 1 cut(s) 489
BseCI ATCGAT 1 cut(s) 30
BseDI CCNNGG 3 cut(s) 67, 340, 447
BseGI GGATG 2 cut(s) 289, 652
BseJI GATNNNNATC 1 cut(s) 489
BseLI CCNNNNNNNGG 4 cut(s) 331, 346, 347, 617
BseMII CTCAG 2 cut(s) 64, 624
BseRI GAGGAG 4 cut(s) 56, 235, 633, 636
BseXI GCAGC 3 cut(s) 66, 105, 466
Bsh1285I CGRYCG 1 cut(s) 252
BshFI GGCC 2 cut(s) 197, 432
BshVI ATCGAT 1 cut(s) 30
BsiEI CGRYCG 1 cut(s) 252
BsiHKCI CYCGRG 1 cut(s) 340
BsiSI CCGG 5 cut(s) 138, 194, 281, 341, 354
BslFI GGGAC 2 cut(s) 107, 518
BslI CCNNNNNNNGG 4 cut(s) 331, 346, 347, 617
BsmAI GTCTC 2 cut(s) 107, 294
BsmBI CGTCTC 2 cut(s) 107, 294
BsmFI GGGAC 2 cut(s) 107, 518
BsnI GGCC 2 cut(s) 197, 432
BsoBI CYCGRG 1 cut(s) 340
Bsp1286I GDGCHC 1 cut(s) 324
Bsp143I GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
Bsp1720I GCTNAGC 1 cut(s) 633
Bsp19I CCATGG 1 cut(s) 447
BspACI CCGC 5 cut(s) 258, 309, 482, 677, 680
BspANI GGCC 2 cut(s) 197, 432
BspCNI CTCAG 2 cut(s) 63, 625
BspDI ATCGAT 1 cut(s) 30
BspLI GGNNCC 4 cut(s) 323, 339, 352, 506
BspMI ACCTGC 1 cut(s) 525
BspPI GGATC 1 cut(s) 530
BsrFI RCCGGY 1 cut(s) 137
BssAI RCCGGY 1 cut(s) 137
BssECI CCNNGG 3 cut(s) 67, 340, 447
BssMI GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
BssSI CACGAG 1 cut(s) 509
BssT1I CCWWGG 1 cut(s) 447
Bst2BI CACGAG 1 cut(s) 509
Bst4CI ACNGT 1 cut(s) 586
BstC8I GCNNGC 5 cut(s) 98, 139, 260, 264, 307
BstDEI CTNAG 3 cut(s) 50, 633, 638
BstDSI CCRYGG 1 cut(s) 447
BstENI CCTNNNNNAGG 1 cut(s) 615
BstF5I GGATG 2 cut(s) 289, 652
BstH2I RGCGCY 2 cut(s) 138, 480
BstHHI GCGC 2 cut(s) 137, 479
BstKTI GATC 8 cut(s) 30, 34, 252, 439, 472, 493, 525, 565
BstMAI GTCTC 2 cut(s) 107, 294
BstMBI GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
BstMCI CGRYCG 1 cut(s) 252
BstMWI GCNNNNNNNGC 1 cut(s) 474
BstSCI CCNGG 3 cut(s) 339, 340, 353
BstV1I GCAGC 3 cut(s) 66, 105, 466
BstV2I GAAGAC 1 cut(s) 582
BstX2I RGATCY 1 cut(s) 436
BstYI RGATCY 1 cut(s) 436
Bsu15I ATCGAT 1 cut(s) 30
BsuRI GGCC 2 cut(s) 197, 432
BsuTUI ATCGAT 1 cut(s) 30
BtgI CCRYGG 1 cut(s) 447
BtrI CACGTC 1 cut(s) 397
BtsCI GGATG 2 cut(s) 289, 652
BveI ACCTGC 1 cut(s) 525
Cac8I GCNNGC 5 cut(s) 98, 139, 260, 264, 307
CfoI GCGC 2 cut(s) 137, 479
Cfr10I RCCGGY 1 cut(s) 137
Cfr13I GGNCC 3 cut(s) 337, 430, 505
Cfr9I CCCGGG 1 cut(s) 340
ClaI ATCGAT 1 cut(s) 30
CseI GACGC 2 cut(s) 89, 311
Csp6I GTAC 1 cut(s) 151
CviAII CATG 5 cut(s) 367, 391, 425, 448, 690
CviQI GTAC 1 cut(s) 151
DdeI CTNAG 3 cut(s) 50, 633, 638
DpnI GATC 8 cut(s) 29, 33, 251, 438, 471, 492, 524, 564
DpnII GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
DrdI GACNNNNNNGTC 1 cut(s) 119
DseDI GACNNNNNNGTC 1 cut(s) 119
EaeI YGGCCR 1 cut(s) 195
Eco130I CCWWGG 1 cut(s) 447
Eco24I GRGCYC 1 cut(s) 324
Eco47I GGWCC 2 cut(s) 337, 505
Eco88I CYCGRG 1 cut(s) 340
EcoNI CCTNNNNNAGG 1 cut(s) 615
EcoO109I RGGNCCY 2 cut(s) 337, 505
EcoRI GAATTC 1 cut(s) 527
EcoT14I CCWWGG 1 cut(s) 447
EcoT38I GRGCYC 1 cut(s) 324
ErhI CCWWGG 1 cut(s) 447
Esp3I CGTCTC 2 cut(s) 107, 294
FaeI CATG 5 cut(s) 370, 394, 428, 451, 693
FaiI YATR 5 cut(s) 368, 392, 426, 449, 691
FaqI GGGAC 2 cut(s) 107, 518
FatI CATG 5 cut(s) 366, 390, 424, 447, 689
FauI CCCGC 2 cut(s) 251, 302
Fnu4HI GCNGC 4 cut(s) 55, 94, 480, 678
FokI GGATG 2 cut(s) 296, 659
FriOI GRGCYC 1 cut(s) 324
Fsp4HI GCNGC 4 cut(s) 55, 94, 480, 678
FspBI CTAG 1 cut(s) 434
GlaI GCGC 2 cut(s) 136, 478
GluI GCNGC 4 cut(s) 55, 94, 480, 678
GsuI CTGGAG 2 cut(s) 115, 308
HaeII RGCGCY 2 cut(s) 138, 480
HaeIII GGCC 2 cut(s) 197, 432
HapII CCGG 5 cut(s) 138, 194, 281, 341, 354
HgaI GACGC 2 cut(s) 89, 311
HhaI GCGC 2 cut(s) 137, 479
Hin1II CATG 5 cut(s) 370, 394, 428, 451, 693
Hin6I GCGC 2 cut(s) 135, 477
HinP1I GCGC 2 cut(s) 135, 477
HincII GTYRAC 1 cut(s) 578
HindII GTYRAC 1 cut(s) 578
HinfI GANTC 1 cut(s) 541
HpaII CCGG 5 cut(s) 138, 194, 281, 341, 354
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 578
Hpy188I TCNGA 3 cut(s) 299, 567, 617
Hpy188III TCNNGA 5 cut(s) 110, 325, 496, 511, 545
Hpy8I GTNNAC 1 cut(s) 578
Hpy99I CGWCG 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 586
HpyCH4IV ACGT 1 cut(s) 396
HpyF10VI GCNNNNNNNGC 1 cut(s) 474
HpyF3I CTNAG 3 cut(s) 50, 633, 638
HpySE526I ACGT 1 cut(s) 396
Hsp92II CATG 5 cut(s) 370, 394, 428, 451, 693
HspAI GCGC 2 cut(s) 135, 477
KroI GCCGGC 1 cut(s) 137
KroNI GCCGGC 1 cut(s) 139
Kzo9I GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
LmnI GCTCC 3 cut(s) 69, 327, 682
Lsp1109I GCAGC 3 cut(s) 66, 105, 466
MaeI CTAG 1 cut(s) 434
MaeII ACGT 1 cut(s) 396
MalI GATC 8 cut(s) 29, 33, 251, 438, 471, 492, 524, 564
MboI GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
MboII GAAGA 2 cut(s) 205, 582
MflI RGATCY 1 cut(s) 436
MhlI GDGCHC 1 cut(s) 324
MluCI AATT 4 cut(s) 232, 514, 527, 669
MlyI GAGTC 1 cut(s) 550
MroNI GCCGGC 1 cut(s) 137
MseI TTAA 2 cut(s) 171, 414
MslI CAYNNNNRTG 3 cut(s) 371, 389, 395
MspI CCGG 5 cut(s) 138, 194, 281, 341, 354
MspR9I CCNGG 3 cut(s) 341, 342, 355
MwoI GCNNNNNNNGC 1 cut(s) 474
NaeI GCCGGC 1 cut(s) 139
NciI CCSGG 3 cut(s) 341, 342, 355
NcoI CCATGG 1 cut(s) 447
NdeII GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
NgoMIV GCCGGC 1 cut(s) 137
NlaIII CATG 5 cut(s) 370, 394, 428, 451, 693
NlaIV GGNNCC 4 cut(s) 323, 339, 352, 506
NmeAIII GCCGAG 1 cut(s) 48
PcsI WCGNNNNNNNCGW 1 cut(s) 117
PdiI GCCGGC 1 cut(s) 139
PflFI GACNNNGTC 1 cut(s) 586
PflMI CCANNNNNTGG 1 cut(s) 331
PkrI GCNGC 4 cut(s) 56, 95, 481, 679
Ple19I CGATCG 1 cut(s) 252
PleI GAGTC 1 cut(s) 549
PpsI GAGTC 1 cut(s) 549
PpuMI RGGWCCY 2 cut(s) 337, 505
PshBI ATTAAT 1 cut(s) 414
Psp5II RGGWCCY 2 cut(s) 337, 505
PspN4I GGNNCC 4 cut(s) 323, 339, 352, 506
PspPI GGNCC 3 cut(s) 337, 430, 505
PspPPI RGGWCCY 2 cut(s) 337, 505
PsuI RGATCY 1 cut(s) 436
PsyI GACNNNGTC 1 cut(s) 586
PvuI CGATCG 1 cut(s) 252
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
RseI CAYNNNNRTG 3 cut(s) 371, 389, 395
SaqAI TTAA 2 cut(s) 171, 414
SatI GCNGC 4 cut(s) 55, 94, 480, 678
Sau3AI GATC 8 cut(s) 27, 31, 249, 436, 469, 490, 522, 562
Sau96I GGNCC 3 cut(s) 337, 430, 505
SchI GAGTC 1 cut(s) 550
ScrFI CCNGG 3 cut(s) 341, 342, 355
SduI GDGCHC 1 cut(s) 324
SinI GGWCC 2 cut(s) 337, 505
SmaI CCCGGG 1 cut(s) 342
SmiMI CAYNNNNRTG 3 cut(s) 371, 389, 395
SmlI CTYRAG 2 cut(s) 59, 494
SmoI CTYRAG 2 cut(s) 59, 494
Sse9I AATT 4 cut(s) 232, 514, 527, 669
SsiI CCGC 5 cut(s) 258, 309, 482, 677, 680
SspMI CTAG 1 cut(s) 434
StyD4I CCNGG 3 cut(s) 339, 340, 353
StyI CCWWGG 1 cut(s) 447
TaaI ACNGT 1 cut(s) 586
TaiI ACGT 1 cut(s) 399
TaqI TCGA 7 cut(s) 30, 155, 248, 359, 381, 525, 539
TasI AATT 4 cut(s) 232, 514, 527, 669
TatI WGTACW 1 cut(s) 150
TauI GCSGC 1 cut(s) 680
Tru1I TTAA 2 cut(s) 171, 414
Tru9I TTAA 2 cut(s) 171, 414
TseI GCWGC 3 cut(s) 54, 93, 479
TspDTI ATGAA 2 cut(s) 355, 444
TspGWI ACGGA 3 cut(s) 177, 214, 669
TspMI CCCGGG 1 cut(s) 340
Tth111I GACNNNGTC 1 cut(s) 586
Van91I CCANNNNNTGG 1 cut(s) 331
VpaK11BI GGWCC 2 cut(s) 337, 505
VspI ATTAAT 1 cut(s) 414
XagI CCTNNNNNAGG 1 cut(s) 615
XapI RAATTY 1 cut(s) 527
XcmI CCANNNNNNNNNTGG 1 cut(s) 86
XmaI CCCGGG 1 cut(s) 340
XspI CTAG 1 cut(s) 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.