Rmu_co8387853.1_g000001

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8387853.1
Physical Location & Seq
Forward (+)
554 .. 826
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8387853.1_g000001.1.cds

Sequence Viewer

Length: 273 bp
atgaaaaggttgcccgtggagtgcgtctcccacatcatttcctttgcatcacctcgcgatgcctgcagatcatcagctgtctgttctctgtttagaatagctgtggattctgatattgtctgggagaggcttcttcctccccattataagcaaatcatttcggaatcttcatcatcgtcctcgtctttcatttccatgcccaagaaggatctctacttttatctctgcactcaccccatcatcataggcaatggtaacatggtaagtaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.08

Weight (kDa)

8.44

Isoelectric Point (pI)

79.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AccII CGCG 1 cut(s) 57
AclWI GGATC 1 cut(s) 216
AluBI AGCT 2 cut(s) 77, 101
AluI AGCT 2 cut(s) 77, 101
Alw26I GTCTC 1 cut(s) 31
AlwI GGATC 1 cut(s) 216
AsuHPI GGTGA 2 cut(s) 42, 224
BarI GAAGNNNNNNTAC 2 cut(s) 197, 229
BccI CCATC 1 cut(s) 245
BcoDI GTCTC 1 cut(s) 31
BfmI CTRYAG 1 cut(s) 64
BmsI GCATC 2 cut(s) 49, 56
BplI GAGNNNNNCTC 2 cut(s) 11, 43
BsaJI CCNNGG 1 cut(s) 15
Bse3DI GCAATG 1 cut(s) 256
BseDI CCNNGG 1 cut(s) 15
BseMI GCAATG 1 cut(s) 256
BsgI GTGCAG 1 cut(s) 211
Bsh1236I CGCG 1 cut(s) 57
BsmAI GTCTC 1 cut(s) 31
BsmBI CGTCTC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 68, 208
Bsp68I TCGCGA 1 cut(s) 57
BspFNI CGCG 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 68
BspPI GGATC 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 256
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 2 cut(s) 68, 208
BstC8I GCNNGC 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 15
BstFNI CGCG 1 cut(s) 57
BstKTI GATC 2 cut(s) 71, 211
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 2 cut(s) 68, 208
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 64
BstUI CGCG 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BtgI CCRYGG 1 cut(s) 15
BtgZI GCGATG 1 cut(s) 72
BtuMI TCGCGA 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 64
CseI GACGC 1 cut(s) 13
CviAII CATG 2 cut(s) 196, 259
CviJI RGCY 3 cut(s) 77, 101, 130
CviKI_1 RGCY 3 cut(s) 77, 101, 130
DpnI GATC 2 cut(s) 70, 210
DpnII GATC 2 cut(s) 68, 208
Esp3I CGTCTC 1 cut(s) 31
FaeI CATG 2 cut(s) 199, 262
FaiI YATR 4 cut(s) 147, 197, 245, 260
FatI CATG 2 cut(s) 195, 258
HgaI GACGC 1 cut(s) 13
Hin1II CATG 2 cut(s) 199, 262
HinfI GANTC 2 cut(s) 107, 164
HphI GGTGA 2 cut(s) 42, 224
Hpy188I TCNGA 2 cut(s) 112, 163
Hpy188III TCNNGA 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 47, 66, 228
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
Hsp92II CATG 2 cut(s) 199, 262
Kzo9I GATC 2 cut(s) 68, 208
LpnPI CCDG 2 cut(s) 76, 106
LweI GCATC 2 cut(s) 49, 56
MaeIII GTNAC 1 cut(s) 254
MalI GATC 2 cut(s) 70, 210
MboI GATC 2 cut(s) 68, 208
MboII GAAGA 2 cut(s) 125, 159
MflI RGATCY 1 cut(s) 208
MluCI AATT 1 cut(s) 268
MnlI CCTC 4 cut(s) 63, 120, 147, 190
MslI CAYNNNNRTG 1 cut(s) 194
MspA1I CMGCKG 1 cut(s) 77
MvnI CGCG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 63
NdeII GATC 2 cut(s) 68, 208
NlaIII CATG 2 cut(s) 199, 262
NruI TCGCGA 1 cut(s) 57
PfeI GAWTC 2 cut(s) 107, 164
PsiI TTATAA 1 cut(s) 147
PstI CTGCAG 1 cut(s) 68
PsuI RGATCY 1 cut(s) 208
PvuII CAGCTG 1 cut(s) 77
RruI TCGCGA 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 194
Sau3AI GATC 2 cut(s) 68, 208
SetI ASST 4 cut(s) 11, 55, 79, 103
SfaNI GCATC 2 cut(s) 49, 56
SfcI CTRYAG 1 cut(s) 64
SgeI CNNG 9 cut(s) 26, 28, 66, 68, 75, 133, 193, 208, 214
SmiMI CAYNNNNRTG 1 cut(s) 194
Sse9I AATT 1 cut(s) 268
TasI AATT 1 cut(s) 268
TfiI GAWTC 2 cut(s) 107, 164
TspDTI ATGAA 3 cut(s) 17, 159, 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.