Rh4CG005000

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
866139 .. 866569
431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG005000.1

Sequence Viewer

Length: 303 bp
ATGGACATGATCAGCATGTTGCCTGTGGAGTGCATCTCCCTCATCATTTCCTTTACATCTCCGCGCGATGCCTGCAGATCATCAGTAGTCTCTCCTGTCTTGAGAATAGCTGGAGATTCTGATTTTGTCTGGGAGAGGTTTCTGCCTCAAGATTATAAGCAAATCATTTTGCAATCCCCGTCATCGTCGTCTTTGAACTCCATGTCCAAGAAGGATCTCTACTTTAGTCTTTGCAGTCACCCCATCAACATAAGCAATCGTAACATGCATGAATATCTAGCACAGTTTGACAATCTTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.39

Weight (kDa)

5.48

Isoelectric Point (pI)

87.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 156
AccII CGCG 2 cut(s) 64, 66
AciI CCGC 1 cut(s) 62
AclWI GGATC 1 cut(s) 222
AgsI TTSAA 1 cut(s) 196
AloI GAACNNNNNNTCC 2 cut(s) 188, 220
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw26I GTCTC 1 cut(s) 94
AlwI GGATC 1 cut(s) 222
AspLEI GCGC 1 cut(s) 66
AsuHPI GGTGA 1 cut(s) 230
BarI GAAGNNNNNNTAC 2 cut(s) 203, 235
BccI CCATC 1 cut(s) 251
BclI TGATCA 1 cut(s) 9
BcoDI GTCTC 1 cut(s) 94
BfaI CTAG 1 cut(s) 278
BfmI CTRYAG 1 cut(s) 73
BmsI GCATC 2 cut(s) 42, 58
BplI GAGNNNNNCTC 2 cut(s) 20, 52
BpmI CTGGAG 1 cut(s) 132
BpuEI CTTGAG 2 cut(s) 121, 132
Bsh1236I CGCG 2 cut(s) 64, 66
BsmAI GTCTC 1 cut(s) 94
Bsp143I GATC 3 cut(s) 9, 77, 214
BspACI CCGC 1 cut(s) 62
BspFNI CGCG 2 cut(s) 64, 66
BspMAI CTGCAG 1 cut(s) 77
BspPI GGATC 1 cut(s) 222
BssMI GATC 3 cut(s) 9, 77, 214
Bst4CI ACNGT 1 cut(s) 285
BstC8I GCNNGC 1 cut(s) 73
BstFNI CGCG 2 cut(s) 64, 66
BstHHI GCGC 1 cut(s) 66
BstKTI GATC 3 cut(s) 12, 80, 217
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 3 cut(s) 9, 77, 214
BstMWI GCNNNNNNNGC 1 cut(s) 72
BstNSI RCATGY 2 cut(s) 19, 268
BstSFI CTRYAG 1 cut(s) 73
BstUI CGCG 2 cut(s) 64, 66
BstX2I RGATCY 1 cut(s) 214
BstYI RGATCY 1 cut(s) 214
BtgZI GCGATG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 73
CfoI GCGC 1 cut(s) 66
CviAII CATG 5 cut(s) 7, 16, 202, 265, 269
CviJI RGCY 1 cut(s) 110
CviKI_1 RGCY 1 cut(s) 110
DpnI GATC 3 cut(s) 11, 79, 216
DpnII GATC 3 cut(s) 9, 77, 214
EcoT22I ATGCAT 1 cut(s) 270
FaeI CATG 5 cut(s) 10, 19, 205, 268, 272
FaiI YATR 7 cut(s) 8, 17, 156, 203, 251, 266, 270
FatI CATG 5 cut(s) 6, 15, 201, 264, 268
FbaI TGATCA 1 cut(s) 9
FspBI CTAG 1 cut(s) 278
GlaI GCGC 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 132
HhaI GCGC 1 cut(s) 66
Hin1II CATG 5 cut(s) 10, 19, 205, 268, 272
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HinfI GANTC 1 cut(s) 116
HphI GGTGA 1 cut(s) 230
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 2 cut(s) 100, 149
Hpy99I CGWCG 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 205
HpyCH4III ACNGT 1 cut(s) 285
HpyCH4V TGCA 5 cut(s) 33, 75, 172, 234, 268
HpyF10VI GCNNNNNNNGC 1 cut(s) 72
Hsp92II CATG 5 cut(s) 10, 19, 205, 268, 272
HspAI GCGC 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 3 cut(s) 9, 77, 214
LpnPI CCDG 5 cut(s) 36, 85, 96, 108, 115
LweI GCATC 2 cut(s) 42, 58
MaeI CTAG 1 cut(s) 278
MaeIII GTNAC 2 cut(s) 236, 260
MalI GATC 3 cut(s) 11, 79, 216
MboI GATC 3 cut(s) 9, 77, 214
MflI RGATCY 1 cut(s) 214
MluCI AATT 1 cut(s) 298
MnlI CCTC 3 cut(s) 50, 129, 156
Mph1103I ATGCAT 1 cut(s) 270
MseI TTAA 1 cut(s) 297
MvnI CGCG 2 cut(s) 64, 66
MwoI GCNNNNNNNGC 1 cut(s) 72
NdeII GATC 3 cut(s) 9, 77, 214
NlaIII CATG 5 cut(s) 10, 19, 205, 268, 272
NmuCI GTSAC 1 cut(s) 236
NsiI ATGCAT 1 cut(s) 270
NspI RCATGY 2 cut(s) 19, 268
PfeI GAWTC 1 cut(s) 116
PsiI TTATAA 1 cut(s) 156
PstI CTGCAG 1 cut(s) 77
PsuI RGATCY 1 cut(s) 214
SaqAI TTAA 1 cut(s) 297
Sau3AI GATC 3 cut(s) 9, 77, 214
SetI ASST 2 cut(s) 112, 140
SfaNI GCATC 2 cut(s) 42, 58
SfcI CTRYAG 1 cut(s) 73
SmlI CTYRAG 2 cut(s) 100, 147
SmoI CTYRAG 2 cut(s) 100, 147
Sse9I AATT 1 cut(s) 298
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 278
TaaI ACNGT 1 cut(s) 285
TasI AATT 1 cut(s) 298
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 297
Tru9I TTAA 1 cut(s) 297
TseFI GTSAC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 236
TspDTI ATGAA 1 cut(s) 285
XceI RCATGY 2 cut(s) 19, 268
XspI CTAG 1 cut(s) 278
Zsp2I ATGCAT 1 cut(s) 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.