Rmu_sc0001066.1_g000013

Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001066.1
Physical Location & Seq
Forward (+)
69004 .. 70012
1009 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001066.1_g000013.1.cds

Sequence Viewer

Length: 897 bp
atgaataagcaatttcggacgctagatcctgataaggcacatgtttactttcttcccttcagtgtgacaatgttggttaagtatgtttatgtgcccaactcacatgatttcggtccaatcaagcaaactgtgagagactatgcgaatcttatctccaccaagtacccgttctggaatagaagcctagcagcagatcactttatggttgcttgccatgattgggggccagaagtttcaaagtctaatgattatcttggtagaaactcgattagggtgctatgcaatgcgaatacatctgaaggcttcaacccttctaaagatgtgtcttttccggagatcaaccttccaaatggaaacacacatggtttaattggtggaccttctccaagggtacgaactgtgctagctttttttgcaggaggacttcatggtcctattaggcctcttttgctggacttgtgggagaacaaagatcaggacatgatggtgcaccagtaccttccaaagggggttgattattataagatgatgagaaagagcaagttctgtctttgtccaagtgggtttgaagttgctagtccaagggtggttgaggcgatttacactggctgtgttccggtgctcatctcagatcattatgtggtgccatttggtgatgctctgaactggaaatcattctctgttgaagtttcagttaatgacattccaaatttgaaaaggatactcatgagcatatctacaagccattatctaagaatgcaaagaaggttgattcaagtgaggaagcattttgagttcaactctcctccaaagcgatttgatgtcttccacatgattttacattctatatggctcagaagactcaatgtcagagttcatgatggcctgccaacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

298

Amino Acids

34.26

Weight (kDa)

9.38

Isoelectric Point (pI)

46.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 522
AasI GACNNNNNNGTC 1 cut(s) 429
AccB1I GGYRCC 1 cut(s) 643
AccIII TCCGGA 1 cut(s) 331
AclWI GGATC 1 cut(s) 20
AcsI RAATTY 1 cut(s) 709
AcuI CTGAAG 2 cut(s) 43, 318
AfaI GTAC 3 cut(s) 164, 393, 497
AfiI CCNNNNNNNGG 2 cut(s) 220, 505
AflIII ACRYGT 1 cut(s) 40
AgsI TTSAA 7 cut(s) 237, 307, 569, 686, 715, 776, 799
AhdI GACNNNNNGTC 1 cut(s) 866
AjuI GAANNNNNNNTTGG 2 cut(s) 152, 184
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
Alw21I GWGCWC 2 cut(s) 492, 624
Alw26I GTCTC 1 cut(s) 129
Alw44I GTGCAC 1 cut(s) 488
AlwI GGATC 1 cut(s) 20
Aor13HI TCCGGA 1 cut(s) 331
AoxI GGCC 3 cut(s) 224, 440, 883
ApaLI GTGCAC 1 cut(s) 488
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 709
Asp700I GAANNNNTTC 1 cut(s) 674
AspS9I GGNCC 4 cut(s) 113, 224, 377, 431
AsuHPI GGTGA 1 cut(s) 665
AsuNHI GCTAGC 1 cut(s) 403
AvaII GGWCC 3 cut(s) 113, 377, 431
BaeGI GKGCMC 2 cut(s) 96, 492
BanI GGYRCC 1 cut(s) 643
BbsI GAAGAC 2 cut(s) 817, 865
Bbv12I GWGCWC 2 cut(s) 492, 624
BbvI GCAGC 1 cut(s) 200
BccI CCATC 2 cut(s) 478, 875
BcgI CGANNNNNNTGC 2 cut(s) 256, 290
BciVI GTATCC 1 cut(s) 714
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 4 cut(s) 23, 185, 404, 576
BfuI GTATCC 1 cut(s) 714
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme18I GGWCC 3 cut(s) 113, 377, 431
BmeRI GACNNNNNGTC 1 cut(s) 866
BmgT120I GGNCC 4 cut(s) 113, 224, 377, 431
BmiI GGNNCC 2 cut(s) 225, 645
BmsI GCATC 1 cut(s) 646
BmtI GCTAGC 1 cut(s) 407
BpiI GAAGAC 2 cut(s) 817, 865
BplI GAGNNNNNCTC 2 cut(s) 785, 817
BsaJI CCNNGG 2 cut(s) 386, 581
BsaWI WCCGGW 2 cut(s) 331, 616
Bsc4I CCNNNNNNNGG 2 cut(s) 220, 505
Bse1I ACTGG 3 cut(s) 493, 610, 671
Bse3DI GCAATG 1 cut(s) 289
BseAI TCCGGA 1 cut(s) 331
BseDI CCNNGG 2 cut(s) 386, 581
BseLI CCNNNNNNNGG 2 cut(s) 220, 505
BseMI GCAATG 1 cut(s) 289
BseMII CTCAG 2 cut(s) 642, 868
BseNI ACTGG 3 cut(s) 493, 610, 671
BseRI GAGGAG 1 cut(s) 795
BseSI GKGCMC 2 cut(s) 96, 492
BseXI GCAGC 1 cut(s) 200
BshFI GGCC 3 cut(s) 226, 442, 885
BshNI GGYRCC 1 cut(s) 643
BsiHKAI GWGCWC 2 cut(s) 492, 624
BsiSI CCGG 2 cut(s) 332, 617
BslI CCNNNNNNNGG 2 cut(s) 220, 505
BsmAI GTCTC 1 cut(s) 129
BsmI GAATGC 1 cut(s) 762
BsnI GGCC 3 cut(s) 226, 442, 885
Bsp1286I GDGCHC 3 cut(s) 96, 492, 624
Bsp13I TCCGGA 1 cut(s) 331
Bsp143I GATC 5 cut(s) 25, 193, 336, 472, 631
BspANI GGCC 3 cut(s) 226, 442, 885
BspCNI CTCAG 2 cut(s) 641, 867
BspEI TCCGGA 1 cut(s) 331
BspHI TCATGA 2 cut(s) 726, 877
BspLI GGNNCC 2 cut(s) 225, 645
BspOI GCTAGC 1 cut(s) 407
BspPI GGATC 1 cut(s) 20
BspT107I GGYRCC 1 cut(s) 643
BsrDI GCAATG 1 cut(s) 289
BsrI ACTGG 3 cut(s) 493, 610, 671
BssECI CCNNGG 2 cut(s) 386, 581
BssMI GATC 5 cut(s) 25, 193, 336, 472, 631
BssT1I CCWWGG 2 cut(s) 386, 581
Bst4CI ACNGT 2 cut(s) 130, 400
BstC8I GCNNGC 3 cut(s) 211, 405, 887
BstDEI CTNAG 3 cut(s) 628, 752, 854
BstENI CCTNNNNNAGG 1 cut(s) 503
BstKTI GATC 5 cut(s) 28, 196, 339, 475, 634
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 5 cut(s) 25, 193, 336, 472, 631
BstMWI GCNNNNNNNGC 2 cut(s) 413, 448
BstNSI RCATGY 1 cut(s) 44
BstSLI GKGCMC 2 cut(s) 96, 492
BstV1I GCAGC 1 cut(s) 200
BstV2I GAAGAC 2 cut(s) 817, 865
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BsuI GTATCC 1 cut(s) 714
BsuRI GGCC 3 cut(s) 226, 442, 885
BtsIMutI CAGTG 2 cut(s) 67, 603
Cac8I GCNNGC 3 cut(s) 211, 405, 887
CciI TCATGA 2 cut(s) 726, 877
Cfr13I GGNCC 4 cut(s) 113, 224, 377, 431
CseI GACGC 1 cut(s) 28
Csp6I GTAC 3 cut(s) 163, 392, 496
CviAII CATG 9 cut(s) 41, 104, 215, 362, 428, 481, 727, 832, 878
CviJI RGCY 9 cut(s) 183, 226, 303, 407, 442, 609, 744, 853, 885
CviKI_1 RGCY 9 cut(s) 183, 226, 303, 407, 442, 609, 744, 853, 885
CviQI GTAC 3 cut(s) 163, 392, 496
DdeI CTNAG 3 cut(s) 628, 752, 854
DpnI GATC 5 cut(s) 27, 195, 338, 474, 633
DpnII GATC 5 cut(s) 25, 193, 336, 472, 631
DrdI GACNNNNNNGTC 1 cut(s) 429
DriI GACNNNNNGTC 1 cut(s) 866
DseDI GACNNNNNNGTC 1 cut(s) 429
Eam1105I GACNNNNNGTC 1 cut(s) 866
Eco130I CCWWGG 2 cut(s) 386, 581
Eco147I AGGCCT 1 cut(s) 442
Eco47I GGWCC 3 cut(s) 113, 377, 431
Eco57I CTGAAG 2 cut(s) 43, 318
EcoNI CCTNNNNNAGG 1 cut(s) 503
EcoT14I CCWWGG 2 cut(s) 386, 581
ErhI CCWWGG 2 cut(s) 386, 581
FaeI CATG 9 cut(s) 44, 107, 218, 365, 431, 484, 730, 835, 881
FatI CATG 9 cut(s) 40, 103, 214, 361, 427, 480, 726, 831, 877
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
FspBI CTAG 4 cut(s) 23, 185, 404, 576
GluI GCNGC 1 cut(s) 189
HaeIII GGCC 3 cut(s) 226, 442, 885
HapII CCGG 2 cut(s) 332, 617
HgaI GACGC 1 cut(s) 28
Hin1II CATG 9 cut(s) 44, 107, 218, 365, 431, 484, 730, 835, 881
HinfI GANTC 3 cut(s) 145, 772, 861
HpaII CCGG 2 cut(s) 332, 617
HphI GGTGA 1 cut(s) 665
Hpy166II GTNNAC 3 cut(s) 46, 377, 490
Hpy188I TCNGA 6 cut(s) 18, 298, 631, 663, 857, 872
Hpy188III TCNNGA 6 cut(s) 29, 172, 332, 476, 727, 878
Hpy8I GTNNAC 3 cut(s) 46, 377, 490
HpyAV CCTTC 7 cut(s) 67, 293, 321, 353, 390, 509, 759
HpyCH4III ACNGT 2 cut(s) 130, 400
HpyCH4V TGCA 4 cut(s) 282, 416, 490, 760
HpyF10VI GCNNNNNNNGC 2 cut(s) 413, 448
HpyF3I CTNAG 3 cut(s) 628, 752, 854
Hsp92II CATG 9 cut(s) 44, 107, 218, 365, 431, 484, 730, 835, 881
Kpn2I TCCGGA 1 cut(s) 331
Kzo9I GATC 5 cut(s) 25, 193, 336, 472, 631
Lsp1109I GCAGC 1 cut(s) 200
LweI GCATC 1 cut(s) 646
MaeI CTAG 4 cut(s) 23, 185, 404, 576
MaeIII GTNAC 1 cut(s) 64
MalI GATC 5 cut(s) 27, 195, 338, 474, 633
MboI GATC 5 cut(s) 25, 193, 336, 472, 631
MboII GAAGA 3 cut(s) 44, 817, 870
MflI RGATCY 1 cut(s) 25
MhlI GDGCHC 3 cut(s) 96, 492, 624
MluCI AATT 3 cut(s) 11, 369, 709
MlyI GAGTC 1 cut(s) 855
MnlI CCTC 5 cut(s) 413, 453, 586, 774, 816
MroI TCCGGA 1 cut(s) 331
MroXI GAANNNNTTC 1 cut(s) 674
MseI TTAA 4 cut(s) 78, 368, 696, 895
MslI CAYNNNNRTG 1 cut(s) 485
MspI CCGG 2 cut(s) 332, 617
Mva1269I GAATGC 1 cut(s) 762
MwoI GCNNNNNNNGC 2 cut(s) 413, 448
NdeII GATC 5 cut(s) 25, 193, 336, 472, 631
NheI GCTAGC 1 cut(s) 403
NlaIII CATG 9 cut(s) 44, 107, 218, 365, 431, 484, 730, 835, 881
NlaIV GGNNCC 2 cut(s) 225, 645
NmuCI GTSAC 1 cut(s) 64
NspI RCATGY 1 cut(s) 44
PagI TCATGA 2 cut(s) 726, 877
PceI AGGCCT 1 cut(s) 442
PciI ACATGT 1 cut(s) 40
PctI GAATGC 1 cut(s) 762
PdmI GAANNNNTTC 1 cut(s) 674
PfeI GAWTC 2 cut(s) 145, 772
PkrI GCNGC 1 cut(s) 190
PleI GAGTC 1 cut(s) 855
PpsI GAGTC 1 cut(s) 855
PscI ACATGT 1 cut(s) 40
PsiI TTATAA 1 cut(s) 522
PspN4I GGNNCC 2 cut(s) 225, 645
PspPI GGNCC 4 cut(s) 113, 224, 377, 431
PsuI RGATCY 1 cut(s) 25
RsaI GTAC 3 cut(s) 164, 393, 497
RsaNI GTAC 3 cut(s) 163, 392, 496
RseI CAYNNNNRTG 1 cut(s) 485
SaqAI TTAA 4 cut(s) 78, 368, 696, 895
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 5 cut(s) 25, 193, 336, 472, 631
Sau96I GGNCC 4 cut(s) 113, 224, 377, 431
SchI GAGTC 1 cut(s) 855
SduI GDGCHC 3 cut(s) 96, 492, 624
SetI ASST 5 cut(s) 345, 382, 409, 501, 770
SfaNI GCATC 1 cut(s) 646
SinI GGWCC 3 cut(s) 113, 377, 431
SmiMI CAYNNNNRTG 1 cut(s) 485
Sse9I AATT 3 cut(s) 11, 369, 709
SseBI AGGCCT 1 cut(s) 442
SspMI CTAG 4 cut(s) 23, 185, 404, 576
StuI AGGCCT 1 cut(s) 442
StyI CCWWGG 2 cut(s) 386, 581
TaaI ACNGT 2 cut(s) 130, 400
TaqI TCGA 1 cut(s) 266
TaqII GACCGA 1 cut(s) 101
TasI AATT 3 cut(s) 11, 369, 709
TfiI GAWTC 2 cut(s) 145, 772
Tru1I TTAA 4 cut(s) 78, 368, 696, 895
Tru9I TTAA 4 cut(s) 78, 368, 696, 895
TscAI CASTG 2 cut(s) 67, 610
TseFI GTSAC 1 cut(s) 64
TseI GCWGC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 3 cut(s) 17, 416, 866
TspRI CASTG 2 cut(s) 67, 610
VneI GTGCAC 1 cut(s) 488
VpaK11BI GGWCC 3 cut(s) 113, 377, 431
XagI CCTNNNNNAGG 1 cut(s) 503
XapI RAATTY 1 cut(s) 709
XceI RCATGY 1 cut(s) 44
XmnI GAANNNNTTC 1 cut(s) 674
XspI CTAG 4 cut(s) 23, 185, 404, 576
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.