Rmu_sc0002645.1_g000011

Lipolytic acyl hydrolase (LAH)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002645.1
OG0001289
Physical Location & Seq
Forward (+)
44275 .. 46172
1898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002645.1_g000011.1.cds

Sequence Viewer

Length: 1167 bp
atgtcgacagctggtttggcagagagaaagatggtgacagtgttaagcattgatggaggtggtattagaggcatcatccccggcactatcctcagcttcctcgaatccaagcttcaggatttggatggcccgagtgcaagacttgcagattattttgatataatcgccggaactagcacaggtgggttggtcaccaccatgcttacagctcccaacaaggacaatcgacccatgtatgaagcaaaggacatcaataacttctacttggaacaagcacctaagattttccctcagaagagtcgaaataacttcttgacatcaattcaaagtttggttggtgcggtgaccggaccaaaatacgacgggaagtacctgagaacattgacgactgggctgcttggcaacctcactataaaagaaactctaaccaatgtcatcattccaacgttcgatatcaaacaccttcagcctgtgattttctcaaccattgatgcaaaagaaagttctttgaaaaatgcaaagctttcagatatctgcatcagtacctctgcagctccaacttttctccccgcacactactttgaggttacggacaaacagggaacaactcgttcttttgatctcgttgatggtggggtcgctgcaaataatcctacaatgatggccataagccacataaacagagagatgttgaagcacgactcagagccattggatgccactcggttactagtgctctcattgggcaccggctccgccaagtctgaagggaagtacacctcagccgaggcctcaaaatggggtttgatcaattggttgtttaacaatgggagcacacctttggttgacatgtttggcgatgcgagtgctgatatggttgacattcatgtctccactctgttccagtccctcaattgcaacgataactacatacgtattcaggatgataatttgatcggtgaggaggcatcagtggacattgcaacagagaagaatctgaagaggcttgtggagatcggaaatgcgctgttgaagaagcgattgtcaagggtaaatctcgatactgggaggtacgaggaatctgagggagaaggtacctacgaagaggcactggtcgattttgccaaacggctcgcggagggaaggaagctcaggcaaaagaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0004620 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0016020 GO:0016298 GO:0016787 GO:0016788 GO:0044424 GO:0044464 GO:0047372 GO:0052689
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Patatin

Protein Analysis

388

Amino Acids

42.42

Weight (kDa)

5.55

Isoelectric Point (pI)

32.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 887
Acc65I GGTACC 1 cut(s) 1094
AccB1I GGYRCC 2 cut(s) 746, 1094
AccI GTMKAC 1 cut(s) 5
AccII CGCG 1 cut(s) 1136
AciI CCGC 4 cut(s) 341, 570, 756, 1136
AclI AACGTT 1 cut(s) 446
AcoI YGGCCR 1 cut(s) 663
AcuI CTGAAG 4 cut(s) 98, 449, 786, 1019
AfaI GTAC 5 cut(s) 371, 544, 776, 1073, 1096
AfiI CCNNNNNNNGG 1 cut(s) 798
AflIII ACRYGT 1 cut(s) 849
AgsI TTSAA 4 cut(s) 326, 511, 694, 1033
AhlI ACTAGT 1 cut(s) 730
AluBI AGCT 7 cut(s) 11, 96, 112, 209, 523, 554, 1150
AluI AGCT 7 cut(s) 11, 96, 112, 209, 523, 554, 1150
Alw21I GWGCWC 2 cut(s) 738, 836
Alw26I GTCTC 1 cut(s) 895
Ama87I CYCGRG 1 cut(s) 130
AoxI GGCC 3 cut(s) 127, 663, 789
ApeKI GCWGC 3 cut(s) 394, 551, 641
ArsI GACNNNNNNTTYG 1 cut(s) 30
Asp718I GGTACC 1 cut(s) 1094
AspLEI GCGC 1 cut(s) 1027
AspS9I GGNCC 2 cut(s) 128, 350
AsuC2I CCSGG 1 cut(s) 81
AsuHPI GGTGA 4 cut(s) 46, 184, 355, 971
AvaI CYCGRG 1 cut(s) 130
AvaII GGWCC 1 cut(s) 350
BaeGI GKGCMC 1 cut(s) 749
BalI TGGCCA 1 cut(s) 665
BanI GGYRCC 2 cut(s) 746, 1094
Bbv12I GWGCWC 2 cut(s) 738, 836
BbvCI CCTCAGC 2 cut(s) 92, 781
BbvI GCAGC 3 cut(s) 381, 563, 628
BccI CCATC 5 cut(s) 25, 47, 119, 623, 655
BceAI ACGGC 1 cut(s) 1145
BcgI CGANNNNNNTGC 4 cut(s) 376, 410, 848, 882
BclI TGATCA 1 cut(s) 807
BcnI CCSGG 1 cut(s) 81
BcoDI GTCTC 1 cut(s) 895
BcuI ACTAGT 1 cut(s) 730
BfaI CTAG 2 cut(s) 174, 731
BfmI CTRYAG 1 cut(s) 549
BisI GCNGC 3 cut(s) 395, 552, 642
BlsI GCNGC 3 cut(s) 396, 553, 643
Bme1390I CCNGG 1 cut(s) 81
Bme18I GGWCC 1 cut(s) 350
BmeT110I CYCGRG 1 cut(s) 130
BmgT120I GGNCC 2 cut(s) 128, 350
BmiI GGNNCC 3 cut(s) 748, 754, 1096
BmrFI CCNGG 1 cut(s) 81
BmrI ACTGGG 2 cut(s) 399, 1074
BmsI GCATC 6 cut(s) 81, 481, 546, 706, 850, 977
BmuI ACTGGG 2 cut(s) 399, 1074
Bpu10I CCTNAGC 3 cut(s) 92, 781, 1151
BpuMI CCSGG 1 cut(s) 81
BsaAI YACGTR 1 cut(s) 935
BsaJI CCNNGG 2 cut(s) 79, 786
BsaWI WCCGGW 1 cut(s) 347
Bsc4I CCNNNNNNNGG 1 cut(s) 798
Bse118I RCCGGY 1 cut(s) 749
Bse1I ACTGG 4 cut(s) 394, 904, 1069, 1116
Bse3DI GCAATG 1 cut(s) 978
BseDI CCNNGG 2 cut(s) 79, 786
BseGI GGATG 4 cut(s) 75, 130, 721, 949
BseLI CCNNNNNNNGG 1 cut(s) 798
BseMI GCAATG 1 cut(s) 978
BseMII CTCAG 7 cut(s) 106, 305, 365, 717, 795, 1074, 1165
BseNI ACTGG 4 cut(s) 394, 904, 1069, 1116
BseRI GAGGAG 1 cut(s) 977
BseSI GKGCMC 1 cut(s) 749
BseXI GCAGC 3 cut(s) 381, 563, 628
Bsh1236I CGCG 1 cut(s) 1136
BshFI GGCC 3 cut(s) 129, 665, 791
BshNI GGYRCC 2 cut(s) 746, 1094
BsiHKAI GWGCWC 2 cut(s) 738, 836
BsiHKCI CYCGRG 1 cut(s) 130
BsiSI CCGG 4 cut(s) 81, 168, 348, 750
BslFI GGGAC 1 cut(s) 892
BslI CCNNNNNNNGG 1 cut(s) 798
BsmAI GTCTC 1 cut(s) 895
BsmFI GGGAC 1 cut(s) 892
BsnI GGCC 3 cut(s) 129, 665, 791
BsoBI CYCGRG 1 cut(s) 130
Bsp1286I GDGCHC 3 cut(s) 738, 749, 836
Bsp143I GATC 4 cut(s) 619, 807, 954, 1014
BspACI CCGC 4 cut(s) 341, 570, 756, 1136
BspANI GGCC 3 cut(s) 129, 665, 791
BspCNI CTCAG 7 cut(s) 105, 304, 366, 716, 794, 1075, 1164
BspFNI CGCG 1 cut(s) 1136
BspLI GGNNCC 3 cut(s) 748, 754, 1096
BspMAI CTGCAG 1 cut(s) 553
BspT107I GGYRCC 2 cut(s) 746, 1094
BsrDI GCAATG 1 cut(s) 978
BsrFI RCCGGY 1 cut(s) 749
BsrI ACTGG 4 cut(s) 394, 904, 1069, 1116
BssAI RCCGGY 1 cut(s) 749
BssECI CCNNGG 2 cut(s) 79, 786
BssMI GATC 4 cut(s) 619, 807, 954, 1014
Bst4CI ACNGT 1 cut(s) 40
Bst6I CTCTTC 3 cut(s) 290, 995, 1098
BstAPI GCANNNNNTGC 1 cut(s) 143
BstBAI YACGTR 1 cut(s) 935
BstC8I GCNNGC 1 cut(s) 1134
BstDEI CTNAG 8 cut(s) 92, 279, 291, 374, 703, 781, 1083, 1151
BstEII GGTNACC 2 cut(s) 190, 343
BstF5I GGATG 4 cut(s) 75, 130, 721, 949
BstFNI CGCG 1 cut(s) 1136
BstHHI GCGC 1 cut(s) 1027
BstKTI GATC 4 cut(s) 622, 810, 957, 1017
BstMAI GTCTC 1 cut(s) 895
BstMBI GATC 4 cut(s) 619, 807, 954, 1014
BstMWI GCNNNNNNNGC 2 cut(s) 17, 143
BstNSI RCATGY 1 cut(s) 853
BstPI GGTNACC 2 cut(s) 190, 343
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 549
BstSLI GKGCMC 1 cut(s) 749
BstSNI TACGTA 1 cut(s) 935
BstUI CGCG 1 cut(s) 1136
BstV1I GCAGC 3 cut(s) 381, 563, 628
BsuRI GGCC 3 cut(s) 129, 665, 791
BtgZI GCGATG 1 cut(s) 873
BtsCI GGATG 4 cut(s) 75, 130, 721, 949
BtsIMutI CAGTG 3 cut(s) 45, 978, 1109
Cac8I GCNNGC 1 cut(s) 1134
CfoI GCGC 1 cut(s) 1027
Cfr10I RCCGGY 1 cut(s) 749
Cfr13I GGNCC 2 cut(s) 128, 350
Csp6I GTAC 5 cut(s) 370, 543, 775, 1072, 1095
CviAII CATG 4 cut(s) 199, 232, 850, 887
CviQI GTAC 5 cut(s) 370, 543, 775, 1072, 1095
DdeI CTNAG 8 cut(s) 92, 279, 291, 374, 703, 781, 1083, 1151
DpnI GATC 4 cut(s) 621, 809, 956, 1016
DpnII GATC 4 cut(s) 619, 807, 954, 1014
DrdI GACNNNNNNGTC 1 cut(s) 887
DseDI GACNNNNNNGTC 1 cut(s) 887
EaeI YGGCCR 1 cut(s) 663
Eam1104I CTCTTC 3 cut(s) 290, 995, 1098
EarI CTCTTC 3 cut(s) 290, 995, 1098
EciI GGCGGA 1 cut(s) 745
Eco105I TACGTA 1 cut(s) 935
Eco147I AGGCCT 1 cut(s) 791
Eco32I GATATC 2 cut(s) 454, 532
Eco47I GGWCC 1 cut(s) 350
Eco57I CTGAAG 4 cut(s) 98, 449, 786, 1019
Eco88I CYCGRG 1 cut(s) 130
Eco91I GGTNACC 2 cut(s) 190, 343
EcoO65I GGTNACC 2 cut(s) 190, 343
EcoRV GATATC 2 cut(s) 454, 532
FaeI CATG 4 cut(s) 202, 235, 853, 890
FaqI GGGAC 1 cut(s) 892
FatI CATG 4 cut(s) 198, 231, 849, 886
FauI CCCGC 1 cut(s) 577
FbaI TGATCA 1 cut(s) 807
FblI GTMKAC 1 cut(s) 5
Fnu4HI GCNGC 3 cut(s) 395, 552, 642
FokI GGATG 4 cut(s) 62, 137, 728, 956
Fsp4HI GCNGC 3 cut(s) 395, 552, 642
FspBI CTAG 2 cut(s) 174, 731
GlaI GCGC 1 cut(s) 1026
GluI GCNGC 3 cut(s) 395, 552, 642
HaeIII GGCC 3 cut(s) 129, 665, 791
HapII CCGG 4 cut(s) 81, 168, 348, 750
HhaI GCGC 1 cut(s) 1027
Hin1II CATG 4 cut(s) 202, 235, 853, 890
Hin6I GCGC 1 cut(s) 1025
HinP1I GCGC 1 cut(s) 1025
HincII GTYRAC 3 cut(s) 6, 847, 880
HindII GTYRAC 3 cut(s) 6, 847, 880
HindIII AAGCTT 2 cut(s) 110, 521
HinfI GANTC 5 cut(s) 104, 298, 701, 994, 1079
HpaII CCGG 4 cut(s) 81, 168, 348, 750
HphI GGTGA 4 cut(s) 46, 184, 355, 971
Hpy166II GTNNAC 5 cut(s) 6, 777, 847, 880, 976
Hpy188I TCNGA 7 cut(s) 294, 529, 706, 766, 999, 1019, 1084
Hpy188III TCNNGA 4 cut(s) 116, 313, 941, 1058
Hpy8I GTNNAC 5 cut(s) 6, 777, 847, 880, 976
Hpy99I CGWCG 1 cut(s) 365
HpyAV CCTTC 4 cut(s) 473, 761, 1085, 1137
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4IV ACGT 2 cut(s) 446, 934
HpyCH4V TGCA 9 cut(s) 137, 146, 494, 518, 537, 551, 644, 918, 983
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 143
HpyF3I CTNAG 8 cut(s) 92, 279, 291, 374, 703, 781, 1083, 1151
HpySE526I ACGT 2 cut(s) 446, 934
Hsp92II CATG 4 cut(s) 202, 235, 853, 890
HspAI GCGC 1 cut(s) 1025
KpnI GGTACC 1 cut(s) 1098
Ksp22I TGATCA 1 cut(s) 807
Kzo9I GATC 4 cut(s) 619, 807, 954, 1014
LmnI GCTCC 4 cut(s) 214, 559, 758, 831
Lsp1109I GCAGC 3 cut(s) 381, 563, 628
LweI GCATC 6 cut(s) 81, 481, 546, 706, 850, 977
MaeI CTAG 2 cut(s) 174, 731
MaeII ACGT 2 cut(s) 446, 934
MaeIII GTNAC 5 cut(s) 34, 190, 343, 586, 726
MalI GATC 4 cut(s) 621, 809, 956, 1016
MboI GATC 4 cut(s) 619, 807, 954, 1014
MboII GAAGA 5 cut(s) 307, 1003, 1012, 1045, 1115
MfeI CAATTG 2 cut(s) 811, 913
MhlI GDGCHC 3 cut(s) 738, 749, 836
MlsI TGGCCA 1 cut(s) 665
MluCI AATT 5 cut(s) 321, 811, 913, 949, 1162
MluNI TGGCCA 1 cut(s) 665
MlyI GAGTC 2 cut(s) 307, 695
MmeI TCCRAC 2 cut(s) 467, 581
Mox20I TGGCCA 1 cut(s) 665
MscI TGGCCA 1 cut(s) 665
MseI TTAA 2 cut(s) 44, 822
MslI CAYNNNNRTG 1 cut(s) 197
Msp20I TGGCCA 1 cut(s) 665
MspA1I CMGCKG 1 cut(s) 11
MspI CCGG 4 cut(s) 81, 168, 348, 750
MspR9I CCNGG 1 cut(s) 81
MunI CAATTG 2 cut(s) 811, 913
MvnI CGCG 1 cut(s) 1136
MwoI GCNNNNNNNGC 2 cut(s) 17, 143
NciI CCSGG 1 cut(s) 81
NdeII GATC 4 cut(s) 619, 807, 954, 1014
NlaIII CATG 4 cut(s) 202, 235, 853, 890
NlaIV GGNNCC 3 cut(s) 748, 754, 1096
NmeAIII GCCGAG 1 cut(s) 811
NmuCI GTSAC 3 cut(s) 34, 190, 343
NspI RCATGY 1 cut(s) 853
PceI AGGCCT 1 cut(s) 791
PciI ACATGT 1 cut(s) 849
PfeI GAWTC 3 cut(s) 104, 994, 1079
PkrI GCNGC 3 cut(s) 396, 553, 643
PleI GAGTC 2 cut(s) 306, 695
PpsI GAGTC 2 cut(s) 306, 695
Ppu21I YACGTR 1 cut(s) 935
PscI ACATGT 1 cut(s) 849
Psp1406I AACGTT 1 cut(s) 446
PspEI GGTNACC 2 cut(s) 190, 343
PspN4I GGNNCC 3 cut(s) 748, 754, 1096
PspPI GGNCC 2 cut(s) 128, 350
PstI CTGCAG 1 cut(s) 553
PvuII CAGCTG 1 cut(s) 11
RsaI GTAC 5 cut(s) 371, 544, 776, 1073, 1096
RsaNI GTAC 5 cut(s) 370, 543, 775, 1072, 1095
RseI CAYNNNNRTG 1 cut(s) 197
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 44, 822
SatI GCNGC 3 cut(s) 395, 552, 642
Sau3AI GATC 4 cut(s) 619, 807, 954, 1014
Sau96I GGNCC 2 cut(s) 128, 350
SchI GAGTC 2 cut(s) 307, 695
ScrFI CCNGG 1 cut(s) 81
SduI GDGCHC 3 cut(s) 738, 749, 836
SfaNI GCATC 6 cut(s) 81, 481, 546, 706, 850, 977
SfcI CTRYAG 1 cut(s) 549
SinI GGWCC 1 cut(s) 350
SmiMI CAYNNNNRTG 1 cut(s) 197
SnaBI TACGTA 1 cut(s) 935
SpeI ACTAGT 1 cut(s) 730
Sse9I AATT 5 cut(s) 321, 811, 913, 949, 1162
SseBI AGGCCT 1 cut(s) 791
SsiI CCGC 4 cut(s) 341, 570, 756, 1136
SspMI CTAG 2 cut(s) 174, 731
StuI AGGCCT 1 cut(s) 791
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 1 cut(s) 40
TaiI ACGT 2 cut(s) 449, 937
TaqI TCGA 7 cut(s) 5, 102, 226, 301, 450, 1059, 1116
TasI AATT 5 cut(s) 321, 811, 913, 949, 1162
TatI WGTACW 1 cut(s) 774
TfiI GAWTC 3 cut(s) 104, 994, 1079
Tru1I TTAA 2 cut(s) 44, 822
Tru9I TTAA 2 cut(s) 44, 822
TscAI CASTG 3 cut(s) 45, 978, 1116
TseFI GTSAC 3 cut(s) 34, 190, 343
TseI GCWGC 3 cut(s) 394, 551, 641
Tsp45I GTSAC 3 cut(s) 34, 190, 343
TspDTI ATGAA 2 cut(s) 252, 875
TspGWI ACGGA 1 cut(s) 605
TspRI CASTG 3 cut(s) 45, 978, 1116
VpaK11BI GGWCC 1 cut(s) 350
XceI RCATGY 1 cut(s) 853
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 2 cut(s) 174, 731
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.