Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006141.1

Orthogroup ID

OG0000952

Physical Location & Seq

Genomic Coordinates Reverse (-)

18761 .. 20561

Gene Structure 1801 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006141.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1533 bp

atgaaacaagaagatttgaaaacgaaaaacgctcaaggtcacacagctcttcacgtagcaacatggaacgggcgtgtgcacattgtgaaagaattggggtcattgatgggagaagtaaaggaggactctggtttcacggctcttcacatagcagtccaggaagggaaggccgatattgtgaaagagttggtgttgttgatgaggcgagaagacttgaaaataaaaaacgacgagggttacacagctcttcacctggccgtcaatatggggaatgtgcctatggtcaaagagcttgtgagaaaagaagaaggtgagaataatattggcgaggacgactttgagcgttatataccgtttaccacatatgtggaaaatggtgattgggataaggcaaatgagtgtcttagagaactagataatccatgtggtgcagtaacagcagtagatccaagagacgactaccgagatactgctcttcatgtagtagcccgagaagggcatttggatgttatcaaaggattggtgttgttgctgaaaatgagacaagaagatttggaattgaaaaccgctgaagatttcacagcttttggttttggtataactttaggggtcagtgaagaattcctcatggaaatggccaaatacatggttgaacagtacgagaaaacacttggcagccttttggagatacaaaaggctgaagggtccacagctcttcacctagcagtactgcaggggtatggggatgttgtgaaagagttggtgccagtaatgagaaaagaaggtttagaaataaaagacgccgatggagacacaactcttaacattgcaatcttagaagggcatgtggatattgcgaaggagttggtgcaatcgatgagacaagaaggtttggaaataaaaaacaaaaacggttccaatgctcttcaccgagcagcattgatgggaaatgtagatattgtgaaagagttggtgccagtaatgagaaaagaaggtttagaaataaaagacgctgatggagacacagctcttaacattgcaatcttagaagggcatgtggatattgcgaaggagttggtgcaatcgatgagacaagaaggtttggaaataaaaaacaaaaacggttccaatgctcttcacctagcggtcgagaatgagcatatgcattttgctagagagctgatggcattgatgagaccagaggctttggaagaaaaagacggtgaaggttatacagctttaagtatcgctattacaagtttcaaggatggagacgtttgcgaaatggctaaattcatggctgaaaagaatgttaaagtacttggcataccctcggctcccgatgatgagattccagttgtcagagcttgttgttttagtaaatggaaatcggctcgctatatgtatgctgtcactccacttgaagctctcgagggacccaatggcagtaaacttatttgcatttgtctcgatgctagcaaaacgattggtaagaccgtaagactactttcactttttaaaagtaagacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 DUF4219

Protein Analysis

510

Amino Acids

56.53

Weight (kDa)

5.1

Isoelectric Point (pI)

28.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000952)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g36310 FvH4_5g36321 FvH4_5g36321 FvH4_5g36321 FvH4_5g36330 FvH4_5g36641 FvH4_5g36641 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090
rosa_chinensis	RchiOBHm_Chr7g0242961 RchiOBHm_Chr7g0242971 RchiOBHm_Chr7g0243041 RchiOBHm_Chr7g0243171
rosa_laevigata	RLG00000000855 RLG00000000860 RLG00000000865 RLG00000018514
rosa_multiflora	Rmu_sc0004165.1_g000086 Rmu_sc0006141.1_g000002
rosa_roxburghii	Rroxscaffold_1G00032610 Rroxscaffold_2G00111620 Rroxscaffold_3G00222210 Rroxscaffold_3G00222250 Rroxscaffold_4G00316280 Rroxscaffold_4G00323300 Rroxscaffold_4G00325490 Rroxscaffold_6G00396710 Rroxscaffold_6G00411010 Rroxscaffold_7G00195780 Rroxscaffold_7G00199210 Rroxscaffold_7G00199220
rosa_rugosa	Rorug05G0523200 Rorug07G0313100 Rorug07G0317800 Rorug07G0318200 Rorug07G0318400 Rorug07G0318500 Rorug07G0318600
rosa_samantha	Rh1AG201600 Rh1CG186500 Rh7AG473500 Rh7AG473800 Rh7AG474100 Rh7AG474300 Rh7BG443400 Rh7BG443700 Rh7BG444000 Rh7BG444100 Rh7BG444600 Rh7CG490600 Rh7CG490900 Rh7DG458800 Rh7DG459100
rosa_wichuraiana	Rw0G003450 Rw7G038980 Rw7G039040 Rw7G039070 Rw7G039390 Rw7G039450 Rw7G039460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	763, 973
AciI	CCGC	2 cut(s)	567, 1145
AclWI	GGATC	1 cut(s)	440
AcoI	YGGCCR	2 cut(s)	255, 636
AcsI	RAATTY	2 cut(s)	620, 1292
AcuI	CTGAAG	2 cut(s)	591, 720
AcyI	GRCGYC	1 cut(s)	801
AdeI	CACNNNGTG	1 cut(s)	85
AfaI	GTAC	3 cut(s)	659, 729, 1320
AfiI	CCNNNNNNNGG	1 cut(s)	495
AgsI	TTSAA	6 cut(s)	19, 217, 562, 653, 1264, 1424
AjnI	CCWGG	2 cut(s)	156, 252
AleI	CACNNNNGTG	1 cut(s)	365
Alw21I	GWGCWC	1 cut(s)	81
Alw26I	GTCTC	9 cut(s)	447, 535, 804, 874, 1014, 1084, 1189, 1266, 1472
Alw44I	GTGCAC	1 cut(s)	77
AlwI	GGATC	1 cut(s)	440
Ama87I	CYCGRG	2 cut(s)	489, 1430
AoxI	GGCC	3 cut(s)	168, 255, 636
ApaLI	GTGCAC	1 cut(s)	77
ApeKI	GCWGC	2 cut(s)	675, 935
ApoI	RAATTY	2 cut(s)	620, 1292
AspS9I	GGNCC	2 cut(s)	705, 1436
AsuHPI	GGTGA	7 cut(s)	242, 323, 389, 710, 920, 1130, 1235
AsuNHI	GCTAGC	1 cut(s)	1475
AvaI	CYCGRG	2 cut(s)	489, 1430
AvaII	GGWCC	2 cut(s)	705, 1436
BaeGI	GKGCMC	1 cut(s)	81
BalI	TGGCCA	1 cut(s)	638
BanI	GGYRCC	2 cut(s)	763, 973
BbsI	GAAGAC	1 cut(s)	216
Bbv12I	GWGCWC	1 cut(s)	81
BbvI	GCAGC	2 cut(s)	687, 947
BccI	CCATC	6 cut(s)	100, 800, 937, 1010, 1177, 1262
BceAI	ACGGC	2 cut(s)	153, 242
BcgI	CGANNNNNNTGC	2 cut(s)	1450, 1484
BciT130I	CCWGG	2 cut(s)	158, 254
BcoDI	GTCTC	9 cut(s)	447, 535, 804, 874, 1014, 1084, 1189, 1266, 1472
BfaI	CTAG	5 cut(s)	413, 722, 1142, 1173, 1476
BfmI	CTRYAG	1 cut(s)	731
BisI	GCNGC	2 cut(s)	676, 936
BlsI	GCNGC	2 cut(s)	677, 937
BmcAI	AGTACT	2 cut(s)	729, 1320
Bme1390I	CCNGG	2 cut(s)	158, 254
Bme18I	GGWCC	2 cut(s)	705, 1436
BmeT110I	CYCGRG	2 cut(s)	489, 1430
BmgT120I	GGNCC	2 cut(s)	705, 1436
BmiI	GGNNCC	8 cut(s)	706, 765, 916, 975, 1126, 1338, 1437, 1438
BmrFI	CCNGG	2 cut(s)	158, 254
BmsI	GCATC	1 cut(s)	1462
BmtI	GCTAGC	1 cut(s)	1479
BpiI	GAAGAC	1 cut(s)	216
BpuEI	CTTGAG	1 cut(s)	18
Bsa29I	ATCGAT	2 cut(s)	875, 1085
BsaAI	YACGTR	1 cut(s)	55
BsaHI	GRCGYC	1 cut(s)	801
BsaI	GGTCTC	1 cut(s)	1189
BsaJI	CCNNGG	1 cut(s)	1332
Bsc4I	CCNNNNNNNGG	1 cut(s)	495
Bse1I	ACTGG	3 cut(s)	767, 977, 1355
Bse3DI	GCAATG	2 cut(s)	825, 1035
BseBI	CCWGG	2 cut(s)	158, 254
BseCI	ATCGAT	2 cut(s)	875, 1085
BseDI	CCNNGG	1 cut(s)	1332
BseGI	GGATG	3 cut(s)	511, 751, 1273
BseLI	CCNNNNNNNGG	1 cut(s)	495
BseMI	GCAATG	2 cut(s)	825, 1035
BseNI	ACTGG	3 cut(s)	767, 977, 1355
BseSI	GKGCMC	1 cut(s)	81
BseXI	GCAGC	2 cut(s)	687, 947
BsgI	GTGCAG	1 cut(s)	450
Bsh1285I	CGRYCG	1 cut(s)	1149
BshFI	GGCC	3 cut(s)	170, 257, 638
BshNI	GGYRCC	2 cut(s)	763, 973
BshVI	ATCGAT	2 cut(s)	875, 1085
BsiEI	CGRYCG	1 cut(s)	1149
BsiHKAI	GWGCWC	1 cut(s)	81
BsiHKCI	CYCGRG	2 cut(s)	489, 1430
BslFI	GGGAC	1 cut(s)	1449
BslI	CCNNNNNNNGG	1 cut(s)	495
BsmAI	GTCTC	9 cut(s)	447, 535, 804, 874, 1014, 1084, 1189, 1266, 1472
BsmBI	CGTCTC	2 cut(s)	447, 1266
BsmFI	GGGAC	1 cut(s)	1449
BsnI	GGCC	3 cut(s)	170, 257, 638
Bso31I	GGTCTC	1 cut(s)	1189
BsoBI	CYCGRG	2 cut(s)	489, 1430
Bsp1286I	GDGCHC	1 cut(s)	81
Bsp143I	GATC	1 cut(s)	445
BspACI	CCGC	2 cut(s)	567, 1145
BspANI	GGCC	3 cut(s)	170, 257, 638
BspDI	ATCGAT	2 cut(s)	875, 1085
BspLI	GGNNCC	8 cut(s)	706, 765, 916, 975, 1126, 1338, 1437, 1438
BspMAI	CTGCAG	1 cut(s)	735
BspOI	GCTAGC	1 cut(s)	1479
BspPI	GGATC	1 cut(s)	440
BspQI	GCTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
BspT107I	GGYRCC	2 cut(s)	763, 973
BspTNI	GGTCTC	1 cut(s)	1189
BsrDI	GCAATG	2 cut(s)	825, 1035
BsrI	ACTGG	3 cut(s)	767, 977, 1355
BssECI	CCNNGG	1 cut(s)	1332
BssMI	GATC	1 cut(s)	445
BssNI	GRCGYC	1 cut(s)	801
Bst2UI	CCWGG	2 cut(s)	158, 254
Bst4CI	ACNGT	6 cut(s)	354, 657, 914, 1124, 1223, 1498
Bst6I	CTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
BstACI	GRCGYC	1 cut(s)	801
BstBAI	YACGTR	1 cut(s)	55
BstC8I	GCNNGC	2 cut(s)	1396, 1477
BstDEI	CTNAG	3 cut(s)	404, 835, 1045
BstF5I	GGATG	3 cut(s)	511, 751, 1273
BstKTI	GATC	1 cut(s)	448
BstMAI	GTCTC	9 cut(s)	447, 535, 804, 874, 1014, 1084, 1189, 1266, 1472
BstMBI	GATC	1 cut(s)	445
BstMCI	CGRYCG	1 cut(s)	1149
BstMWI	GCNNNNNNNGC	1 cut(s)	437
BstNI	CCWGG	2 cut(s)	158, 254
BstNSI	RCATGY	2 cut(s)	848, 1058
BstSCI	CCNGG	2 cut(s)	156, 252
BstSFI	CTRYAG	1 cut(s)	731
BstSLI	GKGCMC	1 cut(s)	81
BstV1I	GCAGC	2 cut(s)	687, 947
BstV2I	GAAGAC	1 cut(s)	216
BstX2I	RGATCY	1 cut(s)	445
BstXI	CCANNNNNNTGG	2 cut(s)	367, 646
BstYI	RGATCY	1 cut(s)	445
Bsu15I	ATCGAT	2 cut(s)	875, 1085
BsuRI	GGCC	3 cut(s)	170, 257, 638
BsuTUI	ATCGAT	2 cut(s)	875, 1085
BtsCI	GGATG	3 cut(s)	511, 751, 1273
BtsIMutI	CAGTG	1 cut(s)	619
Cac8I	GCNNGC	2 cut(s)	1396, 1477
Cfr13I	GGNCC	2 cut(s)	705, 1436
ClaI	ATCGAT	2 cut(s)	875, 1085
CseI	GACGC	2 cut(s)	809, 1019
Csp6I	GTAC	3 cut(s)	658, 728, 1319
CviAII	CATG	8 cut(s)	63, 423, 479, 628, 646, 845, 1055, 1297
CviQI	GTAC	3 cut(s)	658, 728, 1319
DdeI	CTNAG	3 cut(s)	404, 835, 1045
DpnI	GATC	1 cut(s)	447
DpnII	GATC	1 cut(s)	445
DraI	TTTAAA	1 cut(s)	1519
DraIII	CACNNNGTG	1 cut(s)	85
EaeI	YGGCCR	2 cut(s)	255, 636
Eam1104I	CTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
EarI	CTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
Eco31I	GGTCTC	1 cut(s)	1189
Eco47I	GGWCC	2 cut(s)	705, 1436
Eco57I	CTGAAG	2 cut(s)	591, 720
Eco88I	CYCGRG	2 cut(s)	489, 1430
EcoO109I	RGGNCCY	1 cut(s)	1436
EcoRI	GAATTC	1 cut(s)	620
EcoRII	CCWGG	2 cut(s)	156, 252
EcoT22I	ATGCAT	1 cut(s)	1167
Esp3I	CGTCTC	2 cut(s)	447, 1266
FaeI	CATG	8 cut(s)	66, 426, 482, 631, 649, 848, 1058, 1300
FalI	AAGNNNNNCTT	1 cut(s)	1513
FaqI	GGGAC	1 cut(s)	1449
FatI	CATG	8 cut(s)	62, 422, 478, 627, 645, 844, 1054, 1296
FauNDI	CATATG	2 cut(s)	364, 1161
Fnu4HI	GCNGC	2 cut(s)	676, 936
FokI	GGATG	3 cut(s)	518, 758, 1280
Fsp4HI	GCNGC	2 cut(s)	676, 936
FspBI	CTAG	5 cut(s)	413, 722, 1142, 1173, 1476
GluI	GCNGC	2 cut(s)	676, 936
HaeIII	GGCC	3 cut(s)	170, 257, 638
HgaI	GACGC	2 cut(s)	809, 1019
Hin1I	GRCGYC	1 cut(s)	801
Hin1II	CATG	8 cut(s)	66, 426, 482, 631, 649, 848, 1058, 1300
HinfI	GANTC	2 cut(s)	125, 1351
HphI	GGTGA	7 cut(s)	242, 323, 389, 710, 920, 1130, 1235
Hpy166II	GTNNAC	4 cut(s)	79, 357, 708, 1451
Hpy188I	TCNGA	1 cut(s)	1364
Hpy188III	TCNNGA	4 cut(s)	1150, 1340, 1430, 1469
Hpy8I	GTNNAC	4 cut(s)	79, 357, 708, 1451
Hpy99I	CGWCG	1 cut(s)	233
HpyCH4III	ACNGT	6 cut(s)	354, 657, 914, 1124, 1223, 1498
HpyCH4IV	ACGT	2 cut(s)	54, 1275
HpyCH4V	TGCA	9 cut(s)	79, 431, 733, 830, 871, 1040, 1081, 1165, 1461
HpyF10VI	GCNNNNNNNGC	1 cut(s)	437
HpyF3I	CTNAG	3 cut(s)	404, 835, 1045
HpySE526I	ACGT	2 cut(s)	54, 1275
Hsp92I	GRCGYC	1 cut(s)	801
Hsp92II	CATG	8 cut(s)	66, 426, 482, 631, 649, 848, 1058, 1300
KflI	GGGWCCC	1 cut(s)	1436
Kzo9I	GATC	1 cut(s)	445
LguI	GCTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
LmnI	GCTCC	1 cut(s)	1342
Lsp1109I	GCAGC	2 cut(s)	687, 947
LweI	GCATC	1 cut(s)	1462
MaeI	CTAG	5 cut(s)	413, 722, 1142, 1173, 1476
MaeII	ACGT	2 cut(s)	54, 1275
MaeIII	GTNAC	4 cut(s)	38, 236, 433, 1411
MalI	GATC	1 cut(s)	447
MboI	GATC	1 cut(s)	445
MflI	RGATCY	1 cut(s)	445
MhlI	GDGCHC	1 cut(s)	81
MlsI	TGGCCA	1 cut(s)	638
MluCI	AATT	4 cut(s)	92, 557, 620, 1292
MluNI	TGGCCA	1 cut(s)	638
MlyI	GAGTC	1 cut(s)	119
MnlI	CCTC	8 cut(s)	115, 195, 226, 322, 635, 1195, 1342, 1426
Mox20I	TGGCCA	1 cut(s)	638
Mph1103I	ATGCAT	1 cut(s)	1167
MscI	TGGCCA	1 cut(s)	638
MseI	TTAA	5 cut(s)	822, 1032, 1241, 1314, 1518
MslI	CAYNNNNRTG	3 cut(s)	365, 504, 632
Msp20I	TGGCCA	1 cut(s)	638
MspA1I	CMGCKG	1 cut(s)	569
MspR9I	CCNGG	2 cut(s)	158, 254
MvaI	CCWGG	2 cut(s)	158, 254
MwoI	GCNNNNNNNGC	1 cut(s)	437
NdeI	CATATG	2 cut(s)	364, 1161
NdeII	GATC	1 cut(s)	445
NheI	GCTAGC	1 cut(s)	1475
NlaIII	CATG	8 cut(s)	66, 426, 482, 631, 649, 848, 1058, 1300
NlaIV	GGNNCC	8 cut(s)	706, 765, 916, 975, 1126, 1338, 1437, 1438
NmeAIII	GCCGAG	1 cut(s)	1313
NmuCI	GTSAC	2 cut(s)	38, 1411
NsiI	ATGCAT	1 cut(s)	1167
NspI	RCATGY	2 cut(s)	848, 1058
OliI	CACNNNNGTG	1 cut(s)	365
PaeR7I	CTCGAG	1 cut(s)	1430
PciSI	GCTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
PfeI	GAWTC	1 cut(s)	1351
PfoI	TCCNGGA	1 cut(s)	156
PkrI	GCNGC	2 cut(s)	677, 937
PleI	GAGTC	1 cut(s)	119
PpsI	GAGTC	1 cut(s)	119
Ppu21I	YACGTR	1 cut(s)	55
PpuMI	RGGWCCY	1 cut(s)	1436
Psp5II	RGGWCCY	1 cut(s)	1436
Psp6I	CCWGG	2 cut(s)	156, 252
PspGI	CCWGG	2 cut(s)	156, 252
PspN4I	GGNNCC	8 cut(s)	706, 765, 916, 975, 1126, 1338, 1437, 1438
PspPI	GGNCC	2 cut(s)	705, 1436
PspPPI	RGGWCCY	1 cut(s)	1436
PstI	CTGCAG	1 cut(s)	735
PsuI	RGATCY	1 cut(s)	445
RsaI	GTAC	3 cut(s)	659, 729, 1320
RsaNI	GTAC	3 cut(s)	658, 728, 1319
RseI	CAYNNNNRTG	3 cut(s)	365, 504, 632
SapI	GCTCTTC	7 cut(s)	54, 147, 252, 480, 720, 930, 1140
SaqAI	TTAA	5 cut(s)	822, 1032, 1241, 1314, 1518
SatI	GCNGC	2 cut(s)	676, 936
Sau3AI	GATC	1 cut(s)	445
Sau96I	GGNCC	2 cut(s)	705, 1436
ScaI	AGTACT	2 cut(s)	729, 1320
SchI	GAGTC	1 cut(s)	119
ScrFI	CCNGG	2 cut(s)	158, 254
SduI	GDGCHC	1 cut(s)	81
SfaNI	GCATC	1 cut(s)	1462
SfcI	CTRYAG	1 cut(s)	731
Sfr274I	CTCGAG	1 cut(s)	1430
SinI	GGWCC	2 cut(s)	705, 1436
SlaI	CTCGAG	1 cut(s)	1430
SmiMI	CAYNNNNRTG	3 cut(s)	365, 504, 632
SmlI	CTYRAG	2 cut(s)	33, 1430
SmoI	CTYRAG	2 cut(s)	33, 1430
Sse9I	AATT	4 cut(s)	92, 557, 620, 1292
SsiI	CCGC	2 cut(s)	567, 1145
SspI	AATATT	1 cut(s)	322
SspMI	CTAG	5 cut(s)	413, 722, 1142, 1173, 1476
StyD4I	CCNGG	2 cut(s)	156, 252
TaaI	ACNGT	6 cut(s)	354, 657, 914, 1124, 1223, 1498
TaiI	ACGT	2 cut(s)	57, 1278
TaqI	TCGA	5 cut(s)	875, 1085, 1149, 1431, 1470
TasI	AATT	4 cut(s)	92, 557, 620, 1292
TatI	WGTACW	2 cut(s)	727, 1318
TfiI	GAWTC	1 cut(s)	1351
Tru1I	TTAA	5 cut(s)	822, 1032, 1241, 1314, 1518
Tru9I	TTAA	5 cut(s)	822, 1032, 1241, 1314, 1518
TscAI	CASTG	1 cut(s)	619
TseFI	GTSAC	2 cut(s)	38, 1411
TseI	GCWGC	2 cut(s)	675, 935
Tsp45I	GTSAC	2 cut(s)	38, 1411
TspDTI	ATGAA	3 cut(s)	17, 467, 1285
TspRI	CASTG	1 cut(s)	619
VneI	GTGCAC	1 cut(s)	77
VpaK11BI	GGWCC	2 cut(s)	705, 1436
XapI	RAATTY	2 cut(s)	620, 1292
XceI	RCATGY	2 cut(s)	848, 1058
XhoI	CTCGAG	1 cut(s)	1430
XspI	CTAG	5 cut(s)	413, 722, 1142, 1173, 1476
ZrmI	AGTACT	2 cut(s)	729, 1320
Zsp2I	ATGCAT	1 cut(s)	1167

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.