Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000007

Orthogroup ID

OG0000952

Physical Location & Seq

Genomic Coordinates Reverse (-)

32508190 .. 32508966

Gene Structure 777 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug07G0318500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

ATGACAGCCAACACTCAACAGCCCAAAAAACGAAAAACACAAACATTCCATGTTCTTCACCTAATTAACCTCTATCTGCCTTCTTCCTATTCGGGATATTCAACAGACGAAGCAATCAAATTAGGCAACAAGTCAATGGTGGCGGGAATGAGGAAAAGAAATTACAAAATGAGATGGACGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 DUF4219

Protein Analysis

60

Amino Acids

7.02

Weight (kDa)

10.41

Isoelectric Point (pI)

44.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000952)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g36310 FvH4_5g36321 FvH4_5g36321 FvH4_5g36321 FvH4_5g36330 FvH4_5g36641 FvH4_5g36641 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090 FvH4_5g37090
rosa_chinensis	RchiOBHm_Chr7g0242961 RchiOBHm_Chr7g0242971 RchiOBHm_Chr7g0243041 RchiOBHm_Chr7g0243171
rosa_laevigata	RLG00000000855 RLG00000000860 RLG00000000865 RLG00000018514
rosa_multiflora	Rmu_sc0004165.1_g000086 Rmu_sc0006141.1_g000002
rosa_roxburghii	Rroxscaffold_1G00032610 Rroxscaffold_2G00111620 Rroxscaffold_3G00222210 Rroxscaffold_3G00222250 Rroxscaffold_4G00316280 Rroxscaffold_4G00323300 Rroxscaffold_4G00325490 Rroxscaffold_6G00396710 Rroxscaffold_6G00411010 Rroxscaffold_7G00195780 Rroxscaffold_7G00199210 Rroxscaffold_7G00199220
rosa_rugosa	Rorug05G0523200 Rorug07G0313100 Rorug07G0317800 Rorug07G0318200 Rorug07G0318400 Rorug07G0318500 Rorug07G0318600
rosa_samantha	Rh1AG201600 Rh1CG186500 Rh7AG473500 Rh7AG473800 Rh7AG474100 Rh7AG474300 Rh7BG443400 Rh7BG443700 Rh7BG444000 Rh7BG444100 Rh7BG444600 Rh7CG490600 Rh7CG490900 Rh7DG458800 Rh7DG459100
rosa_wichuraiana	Rw0G003450 Rw7G038980 Rw7G039040 Rw7G039070 Rw7G039390 Rw7G039450 Rw7G039460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	143
AgsI	TTSAA	1 cut(s)	102
AsuHPI	GGTGA	1 cut(s)	50
BccI	CCATC	1 cut(s)	168
BspACI	CCGC	1 cut(s)	143
CviAII	CATG	1 cut(s)	50
CviJI	RGCY	2 cut(s)	8, 22
CviKI_1	RGCY	2 cut(s)	8, 22
FaeI	CATG	1 cut(s)	53
FaiI	YATR	1 cut(s)	51
FatI	CATG	1 cut(s)	49
FauI	CCCGC	1 cut(s)	136
Hin1II	CATG	1 cut(s)	53
HphI	GGTGA	1 cut(s)	50
Hpy188III	TCNNGA	1 cut(s)	93
HpyAV	CCTTC	1 cut(s)	90
HpyCH4IV	ACGT	1 cut(s)	179
HpySE526I	ACGT	1 cut(s)	179
Hsp92II	CATG	1 cut(s)	53
MaeII	ACGT	1 cut(s)	179
MboII	GAAGA	2 cut(s)	47, 75
MluCI	AATT	3 cut(s)	63, 119, 160
MnlI	CCTC	2 cut(s)	80, 144
MseI	TTAA	1 cut(s)	66
NlaIII	CATG	1 cut(s)	53
SaqAI	TTAA	1 cut(s)	66
SetI	ASST	3 cut(s)	63, 72, 182
SgeI	CNNG	4 cut(s)	62, 105, 142, 156
Sse9I	AATT	3 cut(s)	63, 119, 160
SsiI	CCGC	1 cut(s)	143
TaiI	ACGT	1 cut(s)	182
TasI	AATT	3 cut(s)	63, 119, 160
Tru1I	TTAA	1 cut(s)	66
Tru9I	TTAA	1 cut(s)	66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.