Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008506.1

Orthogroup ID

OG0000785

Physical Location & Seq

Genomic Coordinates Reverse (-)

80518 .. 82852

Gene Structure 2335 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008506.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 990 bp

atgatcaacattaccggtttatgtttgagaacatctaaaggaggtcttctcatagctgaagccactggagtttctgacacagcacaagggtatccagatactcctggtatatggacaaaggagcaagttgaagcatggaaacccattgtcaatgctgtacatgctaaagggggtatcttcttctgtcagatttggcatgtggggaggctttcaaatactggctttcagccaaatgggcaagtcccaatctcttctactgacaagcccctaacgccccaaatacgagctaatggcgttgatgctgcccagttcacccctccaagacgattaaggacagatgaaattccccaaattgtcaatgattttagacttgctgcaaggaatgctatggaagctggctttgatggggttgaaattcatggtgcccatggctaccttatcgatcaatttttaaaagatcaagtaaatgatcgaacagaccaatatggtggatctctagaaaaacgttgccgatttgcactagacattgttgaagctgttgtcaacgagataggagcagataaagttggaattagattatctccatttgccgactatatggaatccgcagattctaatccaaaggaattgggcctctatctagccaattccttgaacaaatatggaatcctgtactgccacatgtttgagccaagagtggacacagttggggaaaaaattggatgtccccacagtcttgtacccatgagaaaggcttttaatggtaccttcattgctactggtggttttgacagggaagatgggaacaatgctgtggctgagggccgtgcgggtcttattgcttttggtcgttggttcttggctaatccagatttgccaaagagatttgagcttaatgctcctctaaataagtacaacagagatacattctacacatctgatcccgttgttggttacactgattatccatttcttgacagcactgcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0006950 GO:0008150 GO:0008152 GO:0009611 GO:0016491 GO:0016627 GO:0016628 GO:0016629 GO:0044464 GO:0050896 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00592 ko01100 ko01110 map00592 map01100 map01110

Pfam Domains

Protein Families

Oxidored_FMN

Protein Analysis

329

Amino Acids

36.21

Weight (kDa)

5.58

Isoelectric Point (pI)

23.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000785)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09400 AT1G09400 AT1G76680 AT1G76680 AT1G76690
fragaria_vesca	FvH4_5g32630 FvH4_5g32640 FvH4_5g32640 FvH4_5g32680 FvH4_5g32690 FvH4_5g32710
malus_domestica	MD15G1400600.v1.1 MD15G1400700.v1.1 MD15G1401100.v1.1 MD15G1402800.v1.1 MD15G1403000.v1.1
prunus_persica	Prupe.1G549100_v2.0.a1
pyrus_communis	pycom15g35920 pycom15g36030 pycom15g36050
rosa_chinensis	RchiOBHm_Chr7g0230251 RchiOBHm_Chr7g0230261 RchiOBHm_Chr7g0230291 RchiOBHm_Chr7g0230321 RchiOBHm_Chr7g0230331 RchiOBHm_Chr7g0230351
rosa_laevigata	RLG00000001499 RLG00000001500 RLG00000001501 RLG00000001502 RLG00000001503 RLG00000001504 RLG00000001505 RLG00000001506
rosa_multiflora	Rmu_co8106358.1_g000001 Rmu_sc0002541.1_g000035 Rmu_sc0002541.1_g000048 Rmu_sc0002822.1_g000008 Rmu_sc0002822.1_g000009 Rmu_sc0002822.1_g000018 Rmu_sc0003393.1_g000009 Rmu_sc0007103.1_g000020 Rmu_sc0008506.1_g000003 Rmu_sc0008506.1_g000009 Rmu_sc0008506.1_g000016 Rmu_sc0008506.1_g000023 Rmu_sc0033307.1_g000001
rosa_roxburghii	Rroxscaffold_3G00230210 Rroxscaffold_3G00230220 Rroxscaffold_3G00230240 Rroxscaffold_3G00230250 Rroxscaffold_3G00230260 Rroxscaffold_3G00230270
rosa_rugosa	Rorug07G0230900 Rorug07G0231000 Rorug07G0260000
rosa_samantha	Rh7CG428100 Rh7CG428500 Rh7CG428600 Rh7CG428800 Rh7CG428900
rosa_wichuraiana	Rw0G011780 Rw0G012550 Rw0G012570 Rw0G013050 Rw0G022630 Rw0G022640 Rw0G022650 Rw7G034220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	764
AccB1I	GGYRCC	2 cut(s)	422, 764
AciI	CCGC	2 cut(s)	606, 830
AclI	AACGTT	1 cut(s)	505
AclWI	GGATC	2 cut(s)	499, 935
AcsI	RAATTY	2 cut(s)	342, 414
AcuI	CTGAAG	1 cut(s)	78
AfaI	GTAC	5 cut(s)	159, 674, 741, 766, 914
AfiI	CCNNNNNNNGG	1 cut(s)	950
AflIII	ACRYGT	1 cut(s)	681
AgeI	ACCGGT	1 cut(s)	14
AgsI	TTSAA	5 cut(s)	131, 213, 413, 533, 655
AjnI	CCWGG	1 cut(s)	103
AluBI	AGCT	5 cut(s)	56, 287, 395, 536, 892
AluI	AGCT	5 cut(s)	56, 287, 395, 536, 892
AlwI	GGATC	2 cut(s)	499, 935
AoxI	GGCC	2 cut(s)	631, 823
ApeKI	GCWGC	2 cut(s)	302, 374
ApoI	RAATTY	2 cut(s)	342, 414
AsiGI	ACCGGT	1 cut(s)	14
Asp718I	GGTACC	1 cut(s)	764
AspS9I	GGNCC	2 cut(s)	631, 823
AsuHPI	GGTGA	1 cut(s)	304
BaeGI	GKGCMC	1 cut(s)	427
BaeI	ACNNNNGTAYC	2 cut(s)	74, 107
BanI	GGYRCC	2 cut(s)	422, 764
BbsI	GAAGAC	1 cut(s)	38
BbvCI	CCTCAGC	1 cut(s)	819
BbvI	GCAGC	2 cut(s)	289, 361
BccI	CCATC	2 cut(s)	398, 794
BceAI	ACGGC	1 cut(s)	810
BciT130I	CCWGG	1 cut(s)	105
BciVI	GTATCC	1 cut(s)	102
BclI	TGATCA	1 cut(s)	3
BfaI	CTAG	3 cut(s)	497, 521, 641
BfuI	GTATCC	1 cut(s)	102
BglI	GCCNNNNNGGC	1 cut(s)	235
BisI	GCNGC	2 cut(s)	303, 375
BlsI	GCNGC	2 cut(s)	304, 376
Bme1390I	CCNGG	1 cut(s)	105
BmgT120I	GGNCC	2 cut(s)	631, 823
BmiI	GGNNCC	2 cut(s)	424, 766
BmrFI	CCNGG	1 cut(s)	105
BmrI	ACTGGG	1 cut(s)	301
BmsI	GCATC	1 cut(s)	289
BmuI	ACTGGG	1 cut(s)	301
BpiI	GAAGAC	1 cut(s)	38
BplI	GAGNNNNNCTC	2 cut(s)	33, 65
BpmI	CTGGAG	1 cut(s)	87
Bpu10I	CCTNAGC	1 cut(s)	819
Bsa29I	ATCGAT	1 cut(s)	441
BsaBI	GATNNNNATC	1 cut(s)	615
BsaJI	CCNNGG	1 cut(s)	427
BsaWI	WCCGGW	1 cut(s)	14
Bsc4I	CCNNNNNNNGG	1 cut(s)	950
Bse118I	RCCGGY	1 cut(s)	14
Bse1I	ACTGG	4 cut(s)	70, 223, 307, 784
Bse3DI	GCAATG	1 cut(s)	771
Bse8I	GATNNNNATC	1 cut(s)	615
BseBI	CCWGG	1 cut(s)	105
BseCI	ATCGAT	1 cut(s)	441
BseDI	CCNNGG	1 cut(s)	427
BseGI	GGATG	1 cut(s)	728
BseJI	GATNNNNATC	1 cut(s)	615
BseLI	CCNNNNNNNGG	1 cut(s)	950
BseMI	GCAATG	1 cut(s)	771
BseMII	CTCAG	1 cut(s)	810
BseNI	ACTGG	4 cut(s)	70, 223, 307, 784
BseRI	GAGGAG	1 cut(s)	891
BseSI	GKGCMC	1 cut(s)	427
BseXI	GCAGC	2 cut(s)	289, 361
BshFI	GGCC	2 cut(s)	633, 825
BshNI	GGYRCC	2 cut(s)	422, 764
BshTI	ACCGGT	1 cut(s)	14
BshVI	ATCGAT	1 cut(s)	441
BsiSI	CCGG	1 cut(s)	15
BslFI	GGGAC	2 cut(s)	227, 711
BslI	CCNNNNNNNGG	1 cut(s)	950
BsmFI	GGGAC	2 cut(s)	227, 711
BsmI	GAATGC	1 cut(s)	388
BsnI	GGCC	2 cut(s)	633, 825
Bsp1286I	GDGCHC	1 cut(s)	427
Bsp1407I	TGTACA	1 cut(s)	157
Bsp143I	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
Bsp19I	CCATGG	1 cut(s)	427
BspACI	CCGC	2 cut(s)	606, 830
BspANI	GGCC	2 cut(s)	633, 825
BspCNI	CTCAG	1 cut(s)	811
BspDI	ATCGAT	1 cut(s)	441
BspLI	GGNNCC	2 cut(s)	424, 766
BspPI	GGATC	2 cut(s)	499, 935
BspT107I	GGYRCC	2 cut(s)	422, 764
BsrDI	GCAATG	1 cut(s)	771
BsrFI	RCCGGY	1 cut(s)	14
BsrGI	TGTACA	1 cut(s)	157
BsrI	ACTGG	4 cut(s)	70, 223, 307, 784
BssAI	RCCGGY	1 cut(s)	14
BssECI	CCNNGG	1 cut(s)	427
BssMI	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
BssT1I	CCWWGG	1 cut(s)	427
Bst2UI	CCWGG	1 cut(s)	105
Bst4CI	ACNGT	2 cut(s)	706, 734
Bst6I	CTCTTC	1 cut(s)	256
BstAPI	GCANNNNNTGC	1 cut(s)	383
BstAUI	TGTACA	1 cut(s)	157
BstC8I	GCNNGC	1 cut(s)	397
BstDEI	CTNAG	1 cut(s)	819
BstDSI	CCRYGG	1 cut(s)	427
BstF5I	GGATG	1 cut(s)	728
BstKTI	GATC	6 cut(s)	6, 445, 460, 472, 494, 943
BstMBI	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
BstMWI	GCNNNNNNNGC	5 cut(s)	161, 235, 271, 383, 392
BstNI	CCWGG	1 cut(s)	105
BstNSI	RCATGY	3 cut(s)	164, 200, 685
BstSCI	CCNGG	1 cut(s)	103
BstSLI	GKGCMC	1 cut(s)	427
BstV1I	GCAGC	2 cut(s)	289, 361
BstV2I	GAAGAC	1 cut(s)	38
BstX2I	RGATCY	1 cut(s)	491
BstXI	CCANNNNNNTGG	1 cut(s)	488
BstYI	RGATCY	1 cut(s)	491
Bsu15I	ATCGAT	1 cut(s)	441
BsuI	GTATCC	1 cut(s)	102
BsuRI	GGCC	2 cut(s)	633, 825
BsuTUI	ATCGAT	1 cut(s)	441
BtgI	CCRYGG	1 cut(s)	427
BtsCI	GGATG	1 cut(s)	728
BtsI	GCAGTG	1 cut(s)	981
BtsIMutI	CAGTG	3 cut(s)	63, 957, 981
Cac8I	GCNNGC	1 cut(s)	397
Cfr10I	RCCGGY	1 cut(s)	14
Cfr13I	GGNCC	2 cut(s)	631, 823
ClaI	ATCGAT	1 cut(s)	441
Csp6I	GTAC	5 cut(s)	158, 673, 740, 765, 913
CspAI	ACCGGT	1 cut(s)	14
CviAII	CATG	7 cut(s)	135, 161, 197, 419, 428, 682, 745
CviQI	GTAC	5 cut(s)	158, 673, 740, 765, 913
DdeI	CTNAG	1 cut(s)	819
DpnI	GATC	6 cut(s)	5, 444, 459, 471, 493, 942
DpnII	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
DraI	TTTAAA	1 cut(s)	453
Eam1104I	CTCTTC	1 cut(s)	256
EarI	CTCTTC	1 cut(s)	256
Eco130I	CCWWGG	1 cut(s)	427
Eco57I	CTGAAG	1 cut(s)	78
EcoRII	CCWGG	1 cut(s)	103
EcoT14I	CCWWGG	1 cut(s)	427
ErhI	CCWWGG	1 cut(s)	427
FaeI	CATG	7 cut(s)	138, 164, 200, 422, 431, 685, 748
FalI	AAGNNNNNCTT	2 cut(s)	30, 62
FaqI	GGGAC	2 cut(s)	227, 711
FatI	CATG	7 cut(s)	134, 160, 196, 418, 427, 681, 744
FauI	CCCGC	1 cut(s)	823
FbaI	TGATCA	1 cut(s)	3
Fnu4HI	GCNGC	2 cut(s)	303, 375
FokI	GGATG	1 cut(s)	735
Fsp4HI	GCNGC	2 cut(s)	303, 375
FspBI	CTAG	3 cut(s)	497, 521, 641
GluI	GCNGC	2 cut(s)	303, 375
GsuI	CTGGAG	1 cut(s)	87
HaeIII	GGCC	2 cut(s)	633, 825
HapII	CCGG	1 cut(s)	15
Hin1II	CATG	7 cut(s)	138, 164, 200, 422, 431, 685, 748
HincII	GTYRAC	1 cut(s)	544
HindII	GTYRAC	1 cut(s)	544
HinfI	GANTC	3 cut(s)	602, 611, 666
HpaII	CCGG	1 cut(s)	15
HphI	GGTGA	1 cut(s)	304
Hpy166II	GTNNAC	3 cut(s)	312, 544, 700
Hpy188I	TCNGA	3 cut(s)	76, 189, 940
Hpy188III	TCNNGA	4 cut(s)	95, 497, 869, 974
Hpy8I	GTNNAC	3 cut(s)	312, 544, 700
HpyAV	CCTTC	1 cut(s)	778
HpyCH4III	ACNGT	2 cut(s)	706, 734
HpyCH4IV	ACGT	1 cut(s)	505
HpyCH4V	TGCA	2 cut(s)	377, 518
HpyF10VI	GCNNNNNNNGC	5 cut(s)	161, 235, 271, 383, 392
HpyF3I	CTNAG	1 cut(s)	819
HpySE526I	ACGT	1 cut(s)	505
Hsp92II	CATG	7 cut(s)	138, 164, 200, 422, 431, 685, 748
KpnI	GGTACC	1 cut(s)	768
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
LmnI	GCTCC	3 cut(s)	121, 554, 904
Lsp1109I	GCAGC	2 cut(s)	289, 361
LweI	GCATC	1 cut(s)	289
MaeI	CTAG	3 cut(s)	497, 521, 641
MaeII	ACGT	1 cut(s)	505
MaeIII	GTNAC	1 cut(s)	953
MalI	GATC	6 cut(s)	5, 444, 459, 471, 493, 942
MboI	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
MboII	GAAGA	5 cut(s)	38, 169, 172, 243, 809
MflI	RGATCY	1 cut(s)	491
MhlI	GDGCHC	1 cut(s)	427
MluCI	AATT	8 cut(s)	342, 351, 414, 446, 570, 626, 646, 717
MmeI	TCCRAC	1 cut(s)	547
MnlI	CCTC	6 cut(s)	35, 198, 327, 644, 814, 912
MseI	TTAA	4 cut(s)	329, 452, 759, 894
MspI	CCGG	1 cut(s)	15
MspR9I	CCNGG	1 cut(s)	105
Mva1269I	GAATGC	1 cut(s)	388
MvaI	CCWGG	1 cut(s)	105
MwoI	GCNNNNNNNGC	5 cut(s)	161, 235, 271, 383, 392
NcoI	CCATGG	1 cut(s)	427
NdeII	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
NlaIII	CATG	7 cut(s)	138, 164, 200, 422, 431, 685, 748
NlaIV	GGNNCC	2 cut(s)	424, 766
NspI	RCATGY	3 cut(s)	164, 200, 685
PciI	ACATGT	1 cut(s)	681
PctI	GAATGC	1 cut(s)	388
PfeI	GAWTC	3 cut(s)	602, 611, 666
PinAI	ACCGGT	1 cut(s)	14
PkrI	GCNGC	2 cut(s)	304, 376
PscI	ACATGT	1 cut(s)	681
Psp1406I	AACGTT	1 cut(s)	505
Psp6I	CCWGG	1 cut(s)	103
PspGI	CCWGG	1 cut(s)	103
PspN4I	GGNNCC	2 cut(s)	424, 766
PspPI	GGNCC	2 cut(s)	631, 823
PsuI	RGATCY	1 cut(s)	491
RsaI	GTAC	5 cut(s)	159, 674, 741, 766, 914
RsaNI	GTAC	5 cut(s)	158, 673, 740, 765, 913
SaqAI	TTAA	4 cut(s)	329, 452, 759, 894
SatI	GCNGC	2 cut(s)	303, 375
Sau3AI	GATC	6 cut(s)	3, 442, 457, 469, 491, 940
Sau96I	GGNCC	2 cut(s)	631, 823
ScrFI	CCNGG	1 cut(s)	105
SduI	GDGCHC	1 cut(s)	427
SetI	ASST	9 cut(s)	46, 58, 289, 397, 438, 508, 538, 770, 894
SfaNI	GCATC	1 cut(s)	289
Sse9I	AATT	8 cut(s)	342, 351, 414, 446, 570, 626, 646, 717
SsiI	CCGC	2 cut(s)	606, 830
SspMI	CTAG	3 cut(s)	497, 521, 641
StyD4I	CCNGG	1 cut(s)	103
StyI	CCWWGG	1 cut(s)	427
TaaI	ACNGT	2 cut(s)	706, 734
TaiI	ACGT	1 cut(s)	508
TaqI	TCGA	2 cut(s)	441, 472
TasI	AATT	8 cut(s)	342, 351, 414, 446, 570, 626, 646, 717
TatI	WGTACW	3 cut(s)	157, 672, 912
TfiI	GAWTC	3 cut(s)	602, 611, 666
Tru1I	TTAA	4 cut(s)	329, 452, 759, 894
Tru9I	TTAA	4 cut(s)	329, 452, 759, 894
TscAI	CASTG	3 cut(s)	70, 964, 988
TseI	GCWGC	2 cut(s)	302, 374
TspDTI	ATGAA	3 cut(s)	354, 407, 760
TspRI	CASTG	3 cut(s)	70, 964, 988
XapI	RAATTY	2 cut(s)	342, 414
XbaI	TCTAGA	1 cut(s)	496
XceI	RCATGY	3 cut(s)	164, 200, 685
XspI	CTAG	3 cut(s)	497, 521, 641

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.