Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022240.1

Orthogroup ID

OG0001608

Physical Location & Seq

Genomic Coordinates Reverse (-)

4088 .. 8541

Gene Structure 4454 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022240.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 576 bp

atgcagaagctagggtttccgagcatgaggagcttggatcagttcaagtccctctccaaatcggtctcaggaggacctccaaaagaccttcgcctactcttcacgtccaccggagtcgaccttgttgggatgcttggcaaatttgaagctcaccgccggatacaagagtatgttgaagctgcaagcttctgtcaattctggagaccttcctcaccatattcaccatttctaactacatttccttctgtgaatcttgaagtgagagatatagaagggattcctgcgttggaagatgtgggtgaaggagtaataagtgaggaaaagatagtggggagggagttgttggagcttttgagagatgttaaggaccatttcatgaaggcctatgattctggtttggatgtttcaaggatgctagagactaacatggttcagatgctatctgcattggaggagattgaagatctgtcgatccatcagaagacgaagtcagctgcaaaccgccgacccaatgatcggtatacgacggttgaaaaccgtcgtctgatgacgttacatcagacgacgcctcgatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF630 DUF632

Protein Analysis

191

Amino Acids

21.72

Weight (kDa)

6.12

Isoelectric Point (pI)

45.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001608)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g37881
malus_domestica	MD02G1124000.v1.1 MD15G1238000.v1.1
rosa_chinensis	RchiOBHm_Chr2g0125031 RchiOBHm_Chr5g0014171 RchiOBHm_Chr5g0043171 RchiOBHm_Chr5g0076521
rosa_laevigata	RLG00000007907 RLG00000008384 RLG00000009432
rosa_multiflora	Rmu_co8234657.1_g000001 Rmu_sc0022240.1_g000002
rosa_roxburghii	Rroxscaffold_175G00432370 Rroxscaffold_1G00062410 Rroxscaffold_1G00062420 Rroxscaffold_1G00064350 Rroxscaffold_2G00121150 Rroxscaffold_3G00221160 Rroxscaffold_6G00392830 Rroxscaffold_7G00185980
rosa_samantha	Rh1CG046400 Rh2AG316900 Rh2BG321900 Rh2BG569300 Rh2CG328400 Rh2DG412600 Rh3CG300100 Rh4AG111100 Rh4AG163900 Rh4AG221600 Rh4DG159800 Rh5AG289900 Rh5BG247200 Rh5BG296400 Rh5CG119100 Rh5CG556300 Rh5DG305900 Rh5DG529800 Rh6AG197800 Rh6CG246800 Rh6DG138600 Rh6DG238200 Rh7AG475600 Rh7AG479400 Rh7CG460700 Rh7DG258400
rosa_wichuraiana	Rw1G000510 Rw2G014980 Rw4G016950 Rw7G040020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	117, 521
AciI	CCGC	2 cut(s)	154, 502
AclWI	GGATC	2 cut(s)	45, 466
AcsI	RAATTY	1 cut(s)	140
AcyI	GRCGYC	1 cut(s)	566
AfiI	CCNNNNNNNGG	1 cut(s)	516
AgsI	TTSAA	7 cut(s)	46, 146, 176, 257, 408, 461, 533
AjiI	CACGTC	1 cut(s)	105
AluBI	AGCT	7 cut(s)	10, 33, 149, 179, 186, 349, 494
AluI	AGCT	7 cut(s)	10, 33, 149, 179, 186, 349, 494
Alw26I	GTCTC	3 cut(s)	70, 196, 413
AlwI	GGATC	2 cut(s)	45, 466
AoxI	GGCC	1 cut(s)	381
ApeKI	GCWGC	2 cut(s)	179, 494
ApoI	RAATTY	1 cut(s)	140
Asp700I	GAANNNNTTC	1 cut(s)	276
AspS9I	GGNCC	2 cut(s)	74, 367
AsuHPI	GGTGA	4 cut(s)	143, 204, 213, 311
AvaII	GGWCC	2 cut(s)	74, 367
BaeI	ACNNNNGTAYC	2 cut(s)	152, 185
BbsI	GAAGAC	1 cut(s)	488
BbvI	GCAGC	2 cut(s)	166, 481
BccI	CCATC	1 cut(s)	483
BciVI	GTATCC	1 cut(s)	153
BcoDI	GTCTC	3 cut(s)	70, 196, 413
BfaI	CTAG	2 cut(s)	11, 416
BfuI	GTATCC	1 cut(s)	153
BglII	AGATCT	1 cut(s)	463
BisI	GCNGC	2 cut(s)	180, 495
BlsI	GCNGC	2 cut(s)	181, 496
Bme18I	GGWCC	2 cut(s)	74, 367
BmgBI	CACGTC	1 cut(s)	105
BmgT120I	GGNCC	2 cut(s)	74, 367
BmsI	GCATC	3 cut(s)	120, 402, 426
BpiI	GAAGAC	1 cut(s)	488
BpmI	CTGGAG	1 cut(s)	220
BsaHI	GRCGYC	1 cut(s)	566
BsaI	GGTCTC	2 cut(s)	70, 196
BsaWI	WCCGGW	1 cut(s)	110
Bsc4I	CCNNNNNNNGG	1 cut(s)	516
BseGI	GGATG	3 cut(s)	135, 406, 417
BseLI	CCNNNNNNNGG	1 cut(s)	516
BseMII	CTCAG	1 cut(s)	81
BseRI	GAGGAG	2 cut(s)	43, 467
BseXI	GCAGC	2 cut(s)	166, 481
BshFI	GGCC	1 cut(s)	383
BsiSI	CCGG	2 cut(s)	111, 157
BslFI	GGGAC	1 cut(s)	34
BslI	CCNNNNNNNGG	1 cut(s)	516
BsmAI	GTCTC	3 cut(s)	70, 196, 413
BsmFI	GGGAC	1 cut(s)	34
BsnI	GGCC	1 cut(s)	383
Bso31I	GGTCTC	2 cut(s)	70, 196
Bsp143I	GATC	4 cut(s)	37, 463, 471, 514
BspACI	CCGC	2 cut(s)	154, 502
BspANI	GGCC	1 cut(s)	383
BspCNI	CTCAG	1 cut(s)	80
BspHI	TCATGA	1 cut(s)	375
BspPI	GGATC	2 cut(s)	45, 466
BspTNI	GGTCTC	2 cut(s)	70, 196
BssMI	GATC	4 cut(s)	37, 463, 471, 514
BssNAI	GTATAC	1 cut(s)	522
BssNI	GRCGYC	1 cut(s)	566
Bst1107I	GTATAC	1 cut(s)	522
Bst4CI	ACNGT	2 cut(s)	529, 539
Bst6I	CTCTTC	1 cut(s)	104
BstACI	GRCGYC	1 cut(s)	566
BstC8I	GCNNGC	1 cut(s)	184
BstDEI	CTNAG	1 cut(s)	67
BstF5I	GGATG	3 cut(s)	135, 406, 417
BstKTI	GATC	4 cut(s)	40, 466, 474, 517
BstMAI	GTCTC	3 cut(s)	70, 196, 413
BstMBI	GATC	4 cut(s)	37, 463, 471, 514
BstMWI	GCNNNNNNNGC	1 cut(s)	30
BstV1I	GCAGC	2 cut(s)	166, 481
BstV2I	GAAGAC	1 cut(s)	488
BstX2I	RGATCY	1 cut(s)	463
BstYI	RGATCY	1 cut(s)	463
BstZ17I	GTATAC	1 cut(s)	522
BsuI	GTATCC	1 cut(s)	153
BsuRI	GGCC	1 cut(s)	383
BtrI	CACGTC	1 cut(s)	105
BtsCI	GGATG	3 cut(s)	135, 406, 417
Cac8I	GCNNGC	1 cut(s)	184
CciI	TCATGA	1 cut(s)	375
Cfr13I	GGNCC	2 cut(s)	74, 367
CviAII	CATG	3 cut(s)	25, 376, 427
CviJI	RGCY	8 cut(s)	10, 33, 149, 179, 186, 349, 383, 494
CviKI_1	RGCY	8 cut(s)	10, 33, 149, 179, 186, 349, 383, 494
DdeI	CTNAG	1 cut(s)	67
DpnI	GATC	4 cut(s)	39, 465, 473, 516
DpnII	GATC	4 cut(s)	37, 463, 471, 514
Eam1104I	CTCTTC	1 cut(s)	104
EarI	CTCTTC	1 cut(s)	104
Eco147I	AGGCCT	1 cut(s)	383
Eco31I	GGTCTC	2 cut(s)	70, 196
Eco47I	GGWCC	2 cut(s)	74, 367
EcoO109I	RGGNCCY	1 cut(s)	74
FaeI	CATG	3 cut(s)	28, 379, 430
FaiI	YATR	8 cut(s)	26, 171, 217, 269, 377, 387, 428, 522
FaqI	GGGAC	1 cut(s)	34
FatI	CATG	3 cut(s)	24, 375, 426
FblI	GTMKAC	2 cut(s)	117, 521
Fnu4HI	GCNGC	2 cut(s)	180, 495
FokI	GGATG	3 cut(s)	142, 413, 424
Fsp4HI	GCNGC	2 cut(s)	180, 495
FspBI	CTAG	2 cut(s)	11, 416
GluI	GCNGC	2 cut(s)	180, 495
GsuI	CTGGAG	1 cut(s)	220
HaeIII	GGCC	1 cut(s)	383
HapII	CCGG	2 cut(s)	111, 157
Hin1I	GRCGYC	1 cut(s)	566
Hin1II	CATG	3 cut(s)	28, 379, 430
HincII	GTYRAC	1 cut(s)	118
HindII	GTYRAC	1 cut(s)	118
HindIII	AAGCTT	1 cut(s)	184
HinfI	GANTC	4 cut(s)	114, 250, 277, 389
HpaII	CCGG	2 cut(s)	111, 157
HphI	GGTGA	4 cut(s)	143, 204, 213, 311
Hpy166II	GTNNAC	3 cut(s)	108, 118, 522
Hpy188I	TCNGA	5 cut(s)	21, 435, 480, 546, 561
Hpy188III	TCNNGA	4 cut(s)	69, 199, 254, 376
Hpy8I	GTNNAC	3 cut(s)	108, 118, 522
Hpy99I	CGWCG	3 cut(s)	529, 543, 568
HpyAV	CCTTC	6 cut(s)	98, 216, 252, 266, 296, 373
HpyCH4III	ACNGT	2 cut(s)	529, 539
HpyCH4IV	ACGT	2 cut(s)	104, 551
HpyCH4V	TGCA	4 cut(s)	4, 182, 446, 497
HpyF10VI	GCNNNNNNNGC	1 cut(s)	30
HpyF3I	CTNAG	1 cut(s)	67
HpySE526I	ACGT	2 cut(s)	104, 551
Hsp92I	GRCGYC	1 cut(s)	566
Hsp92II	CATG	3 cut(s)	28, 379, 430
Kzo9I	GATC	4 cut(s)	37, 463, 471, 514
LmnI	GCTCC	2 cut(s)	30, 346
LpnPI	CCDG	6 cut(s)	54, 124, 170, 184, 294, 378
Lsp1109I	GCAGC	2 cut(s)	166, 481
LweI	GCATC	3 cut(s)	120, 402, 426
MaeI	CTAG	2 cut(s)	11, 416
MaeII	ACGT	2 cut(s)	104, 551
MaeIII	GTNAC	1 cut(s)	552
MalI	GATC	4 cut(s)	39, 465, 473, 516
MboI	GATC	4 cut(s)	37, 463, 471, 514
MboII	GAAGA	4 cut(s)	91, 302, 473, 493
MflI	RGATCY	1 cut(s)	463
MluCI	AATT	2 cut(s)	140, 194
MlyI	GAGTC	1 cut(s)	123
MmeI	TCCRAC	2 cut(s)	267, 324
MnlI	CCTC	8 cut(s)	21, 62, 65, 87, 220, 310, 327, 445
MroXI	GAANNNNTTC	1 cut(s)	276
MseI	TTAA	1 cut(s)	363
MspA1I	CMGCKG	1 cut(s)	494
MspI	CCGG	2 cut(s)	111, 157
MwoI	GCNNNNNNNGC	1 cut(s)	30
NdeII	GATC	4 cut(s)	37, 463, 471, 514
NlaIII	CATG	3 cut(s)	28, 379, 430
PagI	TCATGA	1 cut(s)	375
PceI	AGGCCT	1 cut(s)	383
PdmI	GAANNNNTTC	1 cut(s)	276
PfeI	GAWTC	3 cut(s)	250, 277, 389
PflFI	GACNNNGTC	1 cut(s)	487
PkrI	GCNGC	2 cut(s)	181, 496
PleI	GAGTC	1 cut(s)	122
PpsI	GAGTC	1 cut(s)	122
PpuMI	RGGWCCY	1 cut(s)	74
Psp5II	RGGWCCY	1 cut(s)	74
PspPI	GGNCC	2 cut(s)	74, 367
PspPPI	RGGWCCY	1 cut(s)	74
PsuI	RGATCY	1 cut(s)	463
PsyI	GACNNNGTC	1 cut(s)	487
PvuII	CAGCTG	1 cut(s)	494
SalI	GTCGAC	1 cut(s)	116
SaqAI	TTAA	1 cut(s)	363
SatI	GCNGC	2 cut(s)	180, 495
Sau3AI	GATC	4 cut(s)	37, 463, 471, 514
Sau96I	GGNCC	2 cut(s)	74, 367
SchI	GAGTC	1 cut(s)	123
SfaNI	GCATC	3 cut(s)	120, 402, 426
SinI	GGWCC	2 cut(s)	74, 367
Sse9I	AATT	2 cut(s)	140, 194
SseBI	AGGCCT	1 cut(s)	383
SsiI	CCGC	2 cut(s)	154, 502
SspMI	CTAG	2 cut(s)	11, 416
StuI	AGGCCT	1 cut(s)	383
TaaI	ACNGT	2 cut(s)	529, 539
TaiI	ACGT	2 cut(s)	107, 554
TaqI	TCGA	3 cut(s)	117, 470, 571
TaqII	GACCGA	1 cut(s)	52
TasI	AATT	2 cut(s)	140, 194
TfiI	GAWTC	3 cut(s)	250, 277, 389
Tru1I	TTAA	1 cut(s)	363
Tru9I	TTAA	1 cut(s)	363
TseI	GCWGC	2 cut(s)	179, 494
TspDTI	ATGAA	2 cut(s)	364, 392
Tth111I	GACNNNGTC	1 cut(s)	487
VpaK11BI	GGWCC	2 cut(s)	74, 367
XapI	RAATTY	1 cut(s)	140
XmiI	GTMKAC	2 cut(s)	117, 521
XmnI	GAANNNNTTC	1 cut(s)	276
XspI	CTAG	2 cut(s)	11, 416

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.