Rroxscaffold_6G00392830

Synaptonemal complex protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
12571671 .. 12575992
4322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00392830.1

Sequence Viewer

Length: 246 bp
ATGAGGAGCTTGGATCAGTTCAAGTCCCTATCCAAATCGGTCTCAGAAGGACCTCCGAGGACGTTCGCCTACTCTTTACGTCCGCCGGAGTCGACTTTGTTGGGAAGCTTGGCGAATTTGAAGCTCACCGCAGAGAAATTGGTGAAGGAGCAAGCTTCTGTGAAAACAGATCTGGAAATGGCAGTACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTGTTCGATGAGCCTGTGA

Protein Analysis

81

Amino Acids

8.78

Weight (kDa)

8.93

Isoelectric Point (pI)

34.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 92
AciI CCGC 2 cut(s) 83, 129
AclWI GGATC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 1 cut(s) 186
AgsI TTSAA 2 cut(s) 22, 121
AluBI AGCT 4 cut(s) 9, 108, 124, 155
AluI AGCT 4 cut(s) 9, 108, 124, 155
Alw26I GTCTC 1 cut(s) 46
AlwI GGATC 1 cut(s) 21
ApoI RAATTY 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 50
AsuHPI GGTGA 2 cut(s) 118, 154
AvaII GGWCC 1 cut(s) 50
BcoDI GTCTC 1 cut(s) 46
BglII AGATCT 1 cut(s) 169
BmcAI AGTACT 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 50
BmgT120I GGNCC 1 cut(s) 50
BsaI GGTCTC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 56
BseMII CTCAG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 19
BsiSI CCGG 1 cut(s) 86
BslFI GGGAC 1 cut(s) 10
BsmAI GTCTC 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 10
Bso31I GGTCTC 1 cut(s) 46
Bsp143I GATC 2 cut(s) 13, 169
BspACI CCGC 2 cut(s) 83, 129
BspCNI CTCAG 1 cut(s) 56
BspPI GGATC 1 cut(s) 21
BspTNI GGTCTC 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 2 cut(s) 13, 169
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 43
BstKTI GATC 2 cut(s) 16, 172
BstMAI GTCTC 1 cut(s) 46
BstMBI GATC 2 cut(s) 13, 169
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 185
CviJI RGCY 5 cut(s) 9, 108, 124, 155, 240
CviKI_1 RGCY 5 cut(s) 9, 108, 124, 155, 240
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 1 cut(s) 43
DpnI GATC 2 cut(s) 15, 171
DpnII GATC 2 cut(s) 13, 169
EciI GGCGGA 1 cut(s) 72
Eco31I GGTCTC 1 cut(s) 46
Eco47I GGWCC 1 cut(s) 50
EcoO109I RGGNCCY 1 cut(s) 50
FaqI GGGAC 1 cut(s) 10
FblI GTMKAC 1 cut(s) 92
HapII CCGG 1 cut(s) 86
HincII GTYRAC 1 cut(s) 93
HindII GTYRAC 1 cut(s) 93
HindIII AAGCTT 2 cut(s) 106, 153
HinfI GANTC 1 cut(s) 89
HpaII CCGG 1 cut(s) 86
HphI GGTGA 2 cut(s) 118, 154
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 2 cut(s) 46, 57
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 2 cut(s) 41, 139
HpyCH4IV ACGT 2 cut(s) 62, 79
HpyF3I CTNAG 1 cut(s) 43
HpySE526I ACGT 2 cut(s) 62, 79
Kzo9I GATC 2 cut(s) 13, 169
LmnI GCTCC 2 cut(s) 6, 148
LpnPI CCDG 2 cut(s) 99, 158
MaeII ACGT 2 cut(s) 62, 79
MalI GATC 2 cut(s) 15, 171
MboI GATC 2 cut(s) 13, 169
MflI RGATCY 1 cut(s) 169
MluCI AATT 2 cut(s) 115, 137
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 2 cut(s) 51, 63
MspI CCGG 1 cut(s) 86
NdeII GATC 2 cut(s) 13, 169
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PpuMI RGGWCCY 1 cut(s) 50
Psp5II RGGWCCY 1 cut(s) 50
PspPI GGNCC 1 cut(s) 50
PspPPI RGGWCCY 1 cut(s) 50
PsuI RGATCY 1 cut(s) 169
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SalI GTCGAC 1 cut(s) 91
Sau3AI GATC 2 cut(s) 13, 169
Sau96I GGNCC 1 cut(s) 50
ScaI AGTACT 1 cut(s) 186
SchI GAGTC 1 cut(s) 98
SetI ASST 7 cut(s) 11, 55, 65, 82, 110, 126, 157
SgeI CNNG 7 cut(s) 22, 34, 69, 98, 121, 164, 185
SinI GGWCC 1 cut(s) 50
Sse9I AATT 2 cut(s) 115, 137
SsiI CCGC 2 cut(s) 83, 129
TaiI ACGT 2 cut(s) 65, 82
TaqI TCGA 2 cut(s) 92, 233
TaqII GACCGA 1 cut(s) 28
TasI AATT 2 cut(s) 115, 137
TatI WGTACW 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 50
XapI RAATTY 1 cut(s) 115
XmiI GTMKAC 1 cut(s) 92
ZrmI AGTACT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.