Rh6CG246800

Protein of unknown function (DUF632)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0001608
Physical Location & Seq
Reverse (-)
41626071 .. 41630652
4582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG246800.1

Sequence Viewer

Length: 237 bp
ATGATGAGAGATAAAGAAGGGATTCCTGCGTTGGAAGATGTGGGTGAAGGAGTAATAAGTGAGGAAAAGATAGTGGGGAGTGAGTTGTTGGAGCTTTTGAGAGATGTTAAGGACCATTTCATGAAGGCCTATGATTCTGGTTTGGATGTTTCAAGGATGCTAGAGTCTAACATGGTTCAGATGCTATCTGCATTGGAGGAGATTGAAGAAGTAGAAGAAAGAAGAGAGGAGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF630 DUF632

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

4.27

Isoelectric Point (pI)

60.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF632 PF04782 29 - 70 8.6e-07 Protein of unknown function (DUF632)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 153, 206
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AoxI GGCC 1 cut(s) 126
Asp700I GAANNNNTTC 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 112
AsuHPI GGTGA 1 cut(s) 56
AvaII GGWCC 1 cut(s) 112
BfaI CTAG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 112
BmsI GCATC 2 cut(s) 147, 171
BseGI GGATG 2 cut(s) 151, 162
BseRI GAGGAG 1 cut(s) 212
BshFI GGCC 1 cut(s) 128
BsnI GGCC 1 cut(s) 128
BspANI GGCC 1 cut(s) 128
BspHI TCATGA 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 217
BstF5I GGATG 2 cut(s) 151, 162
BsuRI GGCC 1 cut(s) 128
BtsCI GGATG 2 cut(s) 151, 162
CciI TCATGA 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 112
CviAII CATG 2 cut(s) 121, 172
CviJI RGCY 2 cut(s) 94, 128
CviKI_1 RGCY 2 cut(s) 94, 128
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco147I AGGCCT 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 112
FaeI CATG 2 cut(s) 124, 175
FaiI YATR 3 cut(s) 122, 132, 173
FatI CATG 2 cut(s) 120, 171
FokI GGATG 2 cut(s) 158, 169
FspBI CTAG 1 cut(s) 161
HaeIII GGCC 1 cut(s) 128
Hin1II CATG 2 cut(s) 124, 175
HinfI GANTC 3 cut(s) 22, 134, 164
HphI GGTGA 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 1 cut(s) 121
HpyAV CCTTC 3 cut(s) 11, 41, 118
HpyCH4V TGCA 1 cut(s) 191
Hsp92II CATG 2 cut(s) 124, 175
LmnI GCTCC 2 cut(s) 91, 229
LpnPI CCDG 2 cut(s) 39, 123
LweI GCATC 2 cut(s) 147, 171
MaeI CTAG 1 cut(s) 161
MboII GAAGA 4 cut(s) 47, 218, 227, 234
MlyI GAGTC 1 cut(s) 173
MmeI TCCRAC 2 cut(s) 12, 69
MnlI CCTC 3 cut(s) 55, 190, 220
MroXI GAANNNNTTC 1 cut(s) 21
MseI TTAA 1 cut(s) 108
NlaIII CATG 2 cut(s) 124, 175
PagI TCATGA 1 cut(s) 120
PceI AGGCCT 1 cut(s) 128
PdmI GAANNNNTTC 1 cut(s) 21
PfeI GAWTC 2 cut(s) 22, 134
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
PspPI GGNCC 1 cut(s) 112
SaqAI TTAA 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 112
SchI GAGTC 1 cut(s) 173
SetI ASST 1 cut(s) 96
SfaNI GCATC 2 cut(s) 147, 171
SgeI CNNG 6 cut(s) 38, 133, 150, 165, 173, 184
SinI GGWCC 1 cut(s) 112
SseBI AGGCCT 1 cut(s) 128
SspMI CTAG 1 cut(s) 161
StuI AGGCCT 1 cut(s) 128
TfiI GAWTC 2 cut(s) 22, 134
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TspDTI ATGAA 2 cut(s) 109, 137
VpaK11BI GGWCC 1 cut(s) 112
XmnI GAANNNNTTC 1 cut(s) 21
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.