Rroxscaffold_7G00185980

Translational activator

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
25407236 .. 25409061
1826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00185980.1

Sequence Viewer

Length: 171 bp
ATGAAGGAAAAGATGTGGTATGTGATATCTCAAAATGAGCCATCACTTCTTCCAATATCCTTGGCTTCAAAATTGTTGATCGAGGACTGCATGGCATGTGTTAATCTTCTTGAAGTCATACTGGTGGAGCATTTGCGAGAGGTTACTATTAATACACAAAGTTATGTTTGA

Protein Analysis

56

Amino Acids

6.45

Weight (kDa)

4.8

Isoelectric Point (pI)

62.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 69, 113
AseI ATTAAT 1 cut(s) 150
BccI CCATC 1 cut(s) 49
BsaJI CCNNGG 1 cut(s) 60
Bse1I ACTGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 126
Bsp143I GATC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 78
BssT1I CCWWGG 1 cut(s) 60
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNSI RCATGY 1 cut(s) 99
CviAII CATG 2 cut(s) 91, 96
CviJI RGCY 2 cut(s) 40, 65
CviKI_1 RGCY 2 cut(s) 40, 65
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 60
Eco32I GATATC 1 cut(s) 27
EcoRV GATATC 1 cut(s) 27
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 94, 99
FaiI YATR 5 cut(s) 21, 92, 97, 119, 165
FatI CATG 2 cut(s) 90, 95
FspEI CC 9 cut(s) 47, 54, 66, 68, 73, 77, 107, 110, 125
Hin1II CATG 2 cut(s) 94, 99
Hpy188III TCNNGA 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 90
Hsp92II CATG 2 cut(s) 94, 99
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 1 cut(s) 107
MaeIII GTNAC 1 cut(s) 142
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 2 cut(s) 41, 98
MluCI AATT 1 cut(s) 71
MnlI CCTC 2 cut(s) 76, 133
MseI TTAA 2 cut(s) 102, 150
MslI CAYNNNNRTG 1 cut(s) 122
NdeII GATC 1 cut(s) 78
NlaIII CATG 2 cut(s) 94, 99
NspI RCATGY 1 cut(s) 99
PshBI ATTAAT 1 cut(s) 150
RseI CAYNNNNRTG 1 cut(s) 122
SaqAI TTAA 2 cut(s) 102, 150
Sau3AI GATC 1 cut(s) 78
SetI ASST 1 cut(s) 144
SgeI CNNG 7 cut(s) 73, 94, 103, 108, 122, 134, 149
SmiMI CAYNNNNRTG 1 cut(s) 122
Sse9I AATT 1 cut(s) 71
StyI CCWWGG 1 cut(s) 60
TaqI TCGA 1 cut(s) 81
TasI AATT 1 cut(s) 71
Tru1I TTAA 2 cut(s) 102, 150
Tru9I TTAA 2 cut(s) 102, 150
TspDTI ATGAA 1 cut(s) 17
VspI ATTAAT 1 cut(s) 150
XceI RCATGY 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.