Rmu_sc0028725.1_g000001

separase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028725.1
Physical Location & Seq
Forward (+)
1 .. 384
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028725.1_g000001.1.cds

Sequence Viewer

Length: 202 bp
agattcagatgatgttagttattctggaataaaggattggaactgtccatggggttccactgtggatgatgatgtagctccagagtttagattgatttggagggggcacttcgtcatctgtgaacatcctgtacaagatacagatgagaaaaagcttcactggtgggtgcagaggaagaattttgatcgccatgcaccttga
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.88

Weight (kDa)

5.08

Isoelectric Point (pI)

16.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 179
AfaI GTAC 1 cut(s) 133
AjuI GAANNNNNNNTTGG 2 cut(s) 20, 52
AluBI AGCT 2 cut(s) 78, 155
AluI AGCT 2 cut(s) 78, 155
ApoI RAATTY 1 cut(s) 179
BaeGI GKGCMC 1 cut(s) 109
BmiI GGNNCC 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 48
BseGI GGATG 2 cut(s) 71, 125
BseNI ACTGG 1 cut(s) 165
BseSI GKGCMC 1 cut(s) 109
BsgI GTGCAG 1 cut(s) 189
Bsp1286I GDGCHC 1 cut(s) 109
Bsp1407I TGTACA 1 cut(s) 131
Bsp143I GATC 1 cut(s) 185
Bsp19I CCATGG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 56
BsrGI TGTACA 1 cut(s) 131
BsrI ACTGG 1 cut(s) 165
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 1 cut(s) 185
BssT1I CCWWGG 1 cut(s) 48
Bst4CI ACNGT 2 cut(s) 45, 62
BstAUI TGTACA 1 cut(s) 131
BstDSI CCRYGG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 71, 125
BstKTI GATC 1 cut(s) 188
BstMBI GATC 1 cut(s) 185
BstSLI GKGCMC 1 cut(s) 109
BtgI CCRYGG 1 cut(s) 48
BtsCI GGATG 2 cut(s) 71, 125
BtsIMutI CAGTG 2 cut(s) 58, 158
Csp6I GTAC 1 cut(s) 132
CviAII CATG 2 cut(s) 49, 192
CviJI RGCY 2 cut(s) 78, 155
CviKI_1 RGCY 2 cut(s) 78, 155
CviQI GTAC 1 cut(s) 132
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
Eco130I CCWWGG 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 2 cut(s) 52, 195
FaiI YATR 2 cut(s) 50, 193
FatI CATG 2 cut(s) 48, 191
FokI GGATG 2 cut(s) 78, 112
GsuI CTGGAG 1 cut(s) 64
Hin1II CATG 2 cut(s) 52, 195
HindIII AAGCTT 1 cut(s) 153
HinfI GANTC 1 cut(s) 3
Hpy166II GTNNAC 1 cut(s) 123
Hpy188I TCNGA 1 cut(s) 8
Hpy188III TCNNGA 2 cut(s) 25, 81
Hpy8I GTNNAC 1 cut(s) 123
HpyCH4III ACNGT 2 cut(s) 45, 62
HpyCH4V TGCA 2 cut(s) 170, 195
Hsp92II CATG 2 cut(s) 52, 195
Kzo9I GATC 1 cut(s) 185
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 4 cut(s) 10, 94, 142, 146
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 1 cut(s) 188
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 179
MnlI CCTC 2 cut(s) 94, 166
NcoI CCATGG 1 cut(s) 48
NdeII GATC 1 cut(s) 185
NlaIII CATG 2 cut(s) 52, 195
NlaIV GGNNCC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 3
PspN4I GGNNCC 1 cut(s) 56
PsrI GAACNNNNNNTAC 2 cut(s) 115, 147
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 185
SduI GDGCHC 1 cut(s) 109
SetI ASST 3 cut(s) 80, 157, 200
SgeI CNNG 6 cut(s) 37, 61, 93, 141, 147, 173
Sse9I AATT 1 cut(s) 179
StyI CCWWGG 1 cut(s) 48
TaaI ACNGT 2 cut(s) 45, 62
TasI AATT 1 cut(s) 179
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 1 cut(s) 3
TscAI CASTG 2 cut(s) 65, 165
TspRI CASTG 2 cut(s) 65, 165
XapI RAATTY 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.