Rroxscaffold_7G00206620

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001195
Physical Location & Seq
Reverse (-)
56395385 .. 56395749
365 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00206620.1

Sequence Viewer

Length: 198 bp
ATGCTTGATACTCCCGCCAAGTCCAAGTCCAAAGAACCAGAGGCTGGTGGAGGTGCTTCTATGGACAAAGGACCATTCTGTGTGCCTTGTCATCTTACATGCCTTGTTGTGTTTGTTATAAGGATCACCACCCGTCTTATTGCCCTTACTTATTCAGTATCCCACAGGGTGCAGCTTTTAACCCTTGCTTTGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.01

Weight (kDa)

9.3

Isoelectric Point (pI)

26.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 119
AccB7I CCANNNNNTGG 1 cut(s) 44
AciI CCGC 1 cut(s) 15
AclWI GGATC 1 cut(s) 131
AdeI CACNNNGTG 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AlwI GGATC 1 cut(s) 131
AlwNI CAGNNNCTG 1 cut(s) 44
ApeKI GCWGC 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 118
AvaII GGWCC 1 cut(s) 71
BbvI GCAGC 1 cut(s) 184
BciVI GTATCC 1 cut(s) 169
BfuI GTATCC 1 cut(s) 169
BisI GCNGC 1 cut(s) 173
BlsI GCNGC 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 184
BsgI GTGCAG 1 cut(s) 191
BslI CCNNNNNNNGG 1 cut(s) 44
Bsp143I GATC 1 cut(s) 123
BspACI CCGC 1 cut(s) 15
BspPI GGATC 1 cut(s) 131
BssMI GATC 1 cut(s) 123
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstNSI RCATGY 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 184
BsuI GTATCC 1 cut(s) 169
CaiI CAGNNNCTG 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 71
CviAII CATG 1 cut(s) 99
CviJI RGCY 2 cut(s) 44, 175
CviKI_1 RGCY 2 cut(s) 44, 175
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
DraIII CACNNNGTG 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 71
FaeI CATG 1 cut(s) 102
FaiI YATR 3 cut(s) 62, 100, 119
FatI CATG 1 cut(s) 98
FauI CCCGC 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 173
Fsp4HI GCNGC 1 cut(s) 173
GluI GCNGC 1 cut(s) 173
Hin1II CATG 1 cut(s) 102
HphI GGTGA 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 172
Hsp92II CATG 1 cut(s) 102
Kzo9I GATC 1 cut(s) 123
LpnPI CCDG 3 cut(s) 30, 51, 151
Lsp1109I GCAGC 1 cut(s) 184
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MnlI CCTC 2 cut(s) 34, 44
MseI TTAA 1 cut(s) 179
NdeII GATC 1 cut(s) 123
NlaIII CATG 1 cut(s) 102
NspI RCATGY 1 cut(s) 102
PflMI CCANNNNNTGG 1 cut(s) 44
PkrI GCNGC 1 cut(s) 174
PsiI TTATAA 1 cut(s) 119
PspPI GGNCC 1 cut(s) 71
PstNI CAGNNNCTG 1 cut(s) 44
SaqAI TTAA 1 cut(s) 179
SatI GCNGC 1 cut(s) 173
Sau3AI GATC 1 cut(s) 123
Sau96I GGNCC 1 cut(s) 71
SetI ASST 2 cut(s) 55, 177
SinI GGWCC 1 cut(s) 71
SsiI CCGC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TseI GCWGC 1 cut(s) 172
Van91I CCANNNNNTGG 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 71
XceI RCATGY 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.