Rh1CG214700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0000788
Physical Location & Seq
Reverse (-)
46128381 .. 46129706
1326 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG214700.1

Sequence Viewer

Length: 225 bp
ATGGCCATAGGACGGGAAATTAGCCAACGCGCCATCACCAATGGTTTGCTGACTTCAACAGCTGTCGATCGTGTTCTGCAAAAGGTTCCACCTTTCTTTACTCTTAATCTTGTTCTAGCTGTGGAGACTTTGAATCAGTTCCGTGGTTGGTGCAAGCTCTCATTATTTTTCGTAAGAATCAAGCAAGAGGTCTTGTGCGATAAAAAGAGCGTTTGGCTGTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.47

Weight (kDa)

9.89

Isoelectric Point (pI)

25.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 30
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 12
AgsI TTSAA 2 cut(s) 57, 133
AluBI AGCT 3 cut(s) 62, 119, 157
AluI AGCT 3 cut(s) 62, 119, 157
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 3
Asp700I GAANNNNTTC 1 cut(s) 137
AspLEI GCGC 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 28
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 12
Bsh1236I CGCG 1 cut(s) 30
Bsh1285I CGRYCG 1 cut(s) 70
BshFI GGCC 1 cut(s) 5
BsiEI CGRYCG 1 cut(s) 70
BslI CCNNNNNNNGG 1 cut(s) 12
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 67
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 30
BspLI GGNNCC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 155
BstDSI CCRYGG 1 cut(s) 142
BstFNI CGCG 1 cut(s) 30
BstHHI GCGC 1 cut(s) 32
BstKTI GATC 1 cut(s) 70
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 67
BstMCI CGRYCG 1 cut(s) 70
BstUI CGCG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 155
CfoI GCGC 1 cut(s) 32
CviJI RGCY 6 cut(s) 5, 24, 62, 119, 157, 217
CviKI_1 RGCY 6 cut(s) 5, 24, 62, 119, 157, 217
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EaeI YGGCCR 1 cut(s) 3
FaiI YATR 2 cut(s) 8, 223
FspBI CTAG 1 cut(s) 116
GlaI GCGC 1 cut(s) 31
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 32
Hin6I GCGC 1 cut(s) 30
HinP1I GCGC 1 cut(s) 30
HinfI GANTC 2 cut(s) 133, 177
HphI GGTGA 1 cut(s) 28
HpyCH4V TGCA 2 cut(s) 79, 153
HspAI GCGC 1 cut(s) 30
Kzo9I GATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 116
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 18
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 181
Mox20I TGGCCA 1 cut(s) 5
MroXI GAANNNNTTC 1 cut(s) 137
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 62
MvnI CGCG 1 cut(s) 30
NdeII GATC 1 cut(s) 67
NlaIV GGNNCC 1 cut(s) 87
PdmI GAANNNNTTC 1 cut(s) 137
PfeI GAWTC 2 cut(s) 133, 177
Ple19I CGATCG 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 87
PvuI CGATCG 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 62
SaqAI TTAA 1 cut(s) 105
Sau3AI GATC 1 cut(s) 67
SetI ASST 6 cut(s) 64, 87, 94, 121, 159, 192
Sse9I AATT 1 cut(s) 18
SspMI CTAG 1 cut(s) 116
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 18
TfiI GAWTC 2 cut(s) 133, 177
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TspGWI ACGGA 1 cut(s) 131
XmnI GAANNNNTTC 1 cut(s) 137
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.