Rh2CG241800

NEDD8-conjugating enzyme Ubc12-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
25152902 .. 25155615
2714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG241800.1

Sequence Viewer

Length: 180 bp
ATGATTGAGCTATTTAAAGTAAAGGAAAAGCAGAGGGAGCTTGCTGAAAATGCCAATGGAAAGTCACTGGTTAAGAAGCAAAGTTCTGGAGAATTACAAAGAAAAATATGGCACAGCATTGCCCCTGAGCATCGGCCTTTACCTAGACGCCTTAATAGCCACAAGGTAGATATTATATAA

Protein Analysis

59

Amino Acids

6.91

Weight (kDa)

10.2

Isoelectric Point (pI)

53.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 148
AluBI AGCT 2 cut(s) 10, 40
AluI AGCT 2 cut(s) 10, 40
AoxI GGCC 1 cut(s) 134
BfaI CTAG 1 cut(s) 144
BmsI GCATC 1 cut(s) 139
BpmI CTGGAG 1 cut(s) 108
Bpu10I CCTNAGC 1 cut(s) 126
BsaHI GRCGYC 1 cut(s) 148
Bse1I ACTGG 1 cut(s) 72
Bse3DI GCAATG 1 cut(s) 117
BseMI GCAATG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 72
BshFI GGCC 1 cut(s) 136
BsnI GGCC 1 cut(s) 136
BspANI GGCC 1 cut(s) 136
BspCNI CTCAG 1 cut(s) 118
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 72
BssNI GRCGYC 1 cut(s) 148
BstACI GRCGYC 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 126
BstMWI GCNNNNNNNGC 3 cut(s) 37, 50, 156
BsuRI GGCC 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 42
CseI GACGC 1 cut(s) 156
CviJI RGCY 4 cut(s) 10, 40, 136, 159
CviKI_1 RGCY 4 cut(s) 10, 40, 136, 159
DdeI CTNAG 1 cut(s) 126
DraI TTTAAA 1 cut(s) 16
FaiI YATR 3 cut(s) 109, 176, 178
FspBI CTAG 1 cut(s) 144
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 1 cut(s) 136
HgaI GACGC 1 cut(s) 156
Hin1I GRCGYC 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 3 cut(s) 37, 50, 156
HpyF3I CTNAG 1 cut(s) 126
Hsp92I GRCGYC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 53, 72, 138
LweI GCATC 1 cut(s) 139
MaeI CTAG 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 63
MluCI AATT 1 cut(s) 92
MnlI CCTC 1 cut(s) 27
MseI TTAA 3 cut(s) 15, 72, 153
MwoI GCNNNNNNNGC 3 cut(s) 37, 50, 156
NmuCI GTSAC 1 cut(s) 63
SaqAI TTAA 3 cut(s) 15, 72, 153
SetI ASST 4 cut(s) 12, 42, 145, 168
SfaNI GCATC 1 cut(s) 139
SgeI CNNG 6 cut(s) 53, 80, 99, 137, 156, 175
Sse9I AATT 1 cut(s) 92
SspMI CTAG 1 cut(s) 144
TasI AATT 1 cut(s) 92
Tru1I TTAA 3 cut(s) 15, 72, 153
Tru9I TTAA 3 cut(s) 15, 72, 153
TscAI CASTG 1 cut(s) 72
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
TspRI CASTG 1 cut(s) 72
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.