Rh4BG279600

NEDD8-conjugating enzyme Ubc12-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
45350953 .. 45356887
5935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG279600.1

Sequence Viewer

Length: 246 bp
ATGATGTGTTCACTTCATCCAGGGGGTCTACCAAGACTCTCGAAACTTTGTCAAGGAATAATGATTGAGCTATTTAAAGTGAAGGAAAAGCAGAGGGAGCTTGCTGAAAATGCCAAAGGAAAGTCACTGGTTAAGAAGCAAAGTTCTGGAGAATTACAAAGGCAGAAGTGGAATAATGAGAGGCAGAATAAAGTTGAGAAAAAGAACTTGAAGTACGCAAAGGAGTTACTTGCAGAAAAGAAATGA

Protein Analysis

81

Amino Acids

9.4

Weight (kDa)

9.97

Isoelectric Point (pI)

35.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AfaI GTAC 1 cut(s) 215
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 2 cut(s) 70, 100
AluI AGCT 2 cut(s) 70, 100
BciT130I CCWGG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 16
BseNI ACTGG 1 cut(s) 132
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 20
Bst2UI CCWGG 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 102
BstF5I GGATG 1 cut(s) 16
BstMWI GCNNNNNNNGC 2 cut(s) 97, 110
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 125
Cac8I GCNNGC 1 cut(s) 102
Csp6I GTAC 1 cut(s) 214
CviJI RGCY 2 cut(s) 70, 100
CviKI_1 RGCY 2 cut(s) 70, 100
CviQI GTAC 1 cut(s) 214
DraI TTTAAA 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 19
FblI GTMKAC 1 cut(s) 28
FokI GGATG 1 cut(s) 3
GsuI CTGGAG 1 cut(s) 168
HinfI GANTC 1 cut(s) 36
Hpy166II GTNNAC 2 cut(s) 11, 29
Hpy188III TCNNGA 2 cut(s) 40, 147
Hpy8I GTNNAC 2 cut(s) 11, 29
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 97, 110
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 4 cut(s) 6, 33, 113, 132
MaeIII GTNAC 2 cut(s) 123, 225
MluCI AATT 1 cut(s) 152
MlyI GAGTC 1 cut(s) 30
MnlI CCTC 2 cut(s) 87, 174
MseI TTAA 2 cut(s) 75, 132
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 2 cut(s) 97, 110
NmuCI GTSAC 1 cut(s) 123
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PsrI GAACNNNNNNTAC 2 cut(s) 197, 229
RsaI GTAC 1 cut(s) 215
RsaNI GTAC 1 cut(s) 214
SaqAI TTAA 2 cut(s) 75, 132
SchI GAGTC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 21
SetI ASST 2 cut(s) 72, 102
Sse9I AATT 1 cut(s) 152
StyD4I CCNGG 1 cut(s) 19
TaqI TCGA 1 cut(s) 41
TasI AATT 1 cut(s) 152
Tru1I TTAA 2 cut(s) 75, 132
Tru9I TTAA 2 cut(s) 75, 132
TscAI CASTG 1 cut(s) 132
TseFI GTSAC 1 cut(s) 123
Tsp45I GTSAC 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 5
TspRI CASTG 1 cut(s) 132
XmiI GTMKAC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.