Rh2BG347700

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
46780339 .. 46780668
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG347700.1

Sequence Viewer

Length: 330 bp
ATGAATACTAGTACTGCAGATAAAGGCACCTTCGTTATCTACACCCTTGACAAGAGGCGCTTTGTGCTTCCCTTGTCCTATCTTTCTAACTACATTTTCCAAGAGCTATTCAAGATGTCTGAAGAAGAATTTGGAATATCGAGTAGTGATCCTATTGTTATCCCATGCGATTCACGCCTCATGGACTACATAGTCTCACTAGTGAAGCTTGGAATGAGTGTAGAGTTGGAGAAAGCTTTACTCAACTCTGTCATTAGAAGTAGTTGCTCCATATCTACTTTTGATCGTCGAGGACAGACAAGCCAACATTTACTCCTCTGTGGTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.36

Weight (kDa)

5.74

Isoelectric Point (pI)

55.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 3 - 67 2.2e-23 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 191
AccB1I GGYRCC 1 cut(s) 26
AclWI GGATC 1 cut(s) 143
AcsI RAATTY 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 141
AfaI GTAC 1 cut(s) 13
AgsI TTSAA 1 cut(s) 112
AhlI ACTAGT 2 cut(s) 8, 199
AjuI GAANNNNNNNTTGG 2 cut(s) 114, 146
AluBI AGCT 3 cut(s) 106, 208, 236
AluI AGCT 3 cut(s) 106, 208, 236
Alw26I GTCTC 1 cut(s) 199
AlwI GGATC 1 cut(s) 143
ApoI RAATTY 1 cut(s) 128
AspLEI GCGC 1 cut(s) 60
BanI GGYRCC 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 199
BcuI ACTAGT 2 cut(s) 8, 199
BfaI CTAG 2 cut(s) 9, 200
BfmI CTRYAG 1 cut(s) 15
BfoI RGCGCY 1 cut(s) 61
BmcAI AGTACT 1 cut(s) 13
BmiI GGNNCC 1 cut(s) 28
BsaXI ACNNNNNCTCC 2 cut(s) 297, 327
BseRI GAGGAG 1 cut(s) 305
BshNI GGYRCC 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 199
Bsp143I GATC 2 cut(s) 148, 283
BspLI GGNNCC 1 cut(s) 28
BspMAI CTGCAG 1 cut(s) 19
BspPI GGATC 1 cut(s) 143
BspT107I GGYRCC 1 cut(s) 26
BssMI GATC 2 cut(s) 148, 283
BstH2I RGCGCY 1 cut(s) 61
BstHHI GCGC 1 cut(s) 60
BstKTI GATC 2 cut(s) 151, 286
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 2 cut(s) 148, 283
BstMWI GCNNNNNNNGC 2 cut(s) 64, 174
BstSFI CTRYAG 1 cut(s) 15
CfoI GCGC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 12
CviAII CATG 2 cut(s) 165, 181
CviJI RGCY 4 cut(s) 106, 208, 236, 303
CviKI_1 RGCY 4 cut(s) 106, 208, 236, 303
CviQI GTAC 1 cut(s) 12
DpnI GATC 2 cut(s) 150, 285
DpnII GATC 2 cut(s) 148, 283
DrdI GACNNNNNNGTC 1 cut(s) 191
DseDI GACNNNNNNGTC 1 cut(s) 191
Eco57I CTGAAG 1 cut(s) 141
FaeI CATG 2 cut(s) 168, 184
FaiI YATR 4 cut(s) 166, 182, 191, 272
FalI AAGNNNNNCTT 2 cut(s) 44, 76
FatI CATG 2 cut(s) 164, 180
FspBI CTAG 2 cut(s) 9, 200
GlaI GCGC 1 cut(s) 59
HaeII RGCGCY 1 cut(s) 61
HhaI GCGC 1 cut(s) 60
Hin1II CATG 2 cut(s) 168, 184
Hin6I GCGC 1 cut(s) 58
HinP1I GCGC 1 cut(s) 58
HindIII AAGCTT 2 cut(s) 206, 234
HinfI GANTC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 112
Hpy99I CGWCG 1 cut(s) 291
HpyAV CCTTC 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 17
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 174
Hsp92II CATG 2 cut(s) 168, 184
HspAI GCGC 1 cut(s) 58
Kzo9I GATC 2 cut(s) 148, 283
LmnI GCTCC 1 cut(s) 272
MaeI CTAG 2 cut(s) 9, 200
MaeIII GTNAC 1 cut(s) 323
MalI GATC 2 cut(s) 150, 285
MboI GATC 2 cut(s) 148, 283
MboII GAAGA 2 cut(s) 134, 137
MluCI AATT 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 207
MnlI CCTC 4 cut(s) 48, 188, 284, 326
MwoI GCNNNNNNNGC 2 cut(s) 64, 174
NdeII GATC 2 cut(s) 148, 283
NlaIII CATG 2 cut(s) 168, 184
NlaIV GGNNCC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 28
PstI CTGCAG 1 cut(s) 19
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
Sau3AI GATC 2 cut(s) 148, 283
ScaI AGTACT 1 cut(s) 13
SetI ASST 4 cut(s) 32, 108, 210, 238
SfcI CTRYAG 1 cut(s) 15
SpeI ACTAGT 2 cut(s) 8, 199
Sse9I AATT 1 cut(s) 128
SspMI CTAG 2 cut(s) 9, 200
TaqI TCGA 2 cut(s) 140, 289
TasI AATT 1 cut(s) 128
TatI WGTACW 1 cut(s) 11
TfiI GAWTC 1 cut(s) 170
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 128
XspI CTAG 2 cut(s) 9, 200
ZrmI AGTACT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.