Rh2CG326400

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0000790
Physical Location & Seq
Reverse (-)
42283975 .. 42284421
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG326400.1

Sequence Viewer

Length: 447 bp
ATGGACATTCTAATTAGTCCAAAGAAGCTCATCAAACTGACCAGGAACTTGCAGAAGCTACCAGTTATTGGGAGAAGGAAAACTTCATACCAAAGAGCAGCTGTCGACGGTAACAGGATGAATACTAGTACTGCAGATAAAGGCACCTTCGTTATCTACACCCTTGACAAGAGGCGCTTTGTGCTTCCCTTGTCCTATCTTTCTAACTACATTTTCCAAGAGCTATTCAAGATGTCTGAAGAAGAATTTGGAATATCGAGTAGTGATCCTATTGTTATCCCATGCGATTCACGCCTCATGGACTACATAGTCTCACTAGTGAAGCTTGGAATGAGTATAGAGTTGGAGAAAGCTTTACTCAACTCTATCATTAGAAGTAGTTGCTCCATATCTACTTCTGATCGTCGAGGACGGACAAGCCAACAATTACTCCTCTGTGGTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

148

Amino Acids

16.82

Weight (kDa)

9.6

Isoelectric Point (pI)

55.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 8 - 106 2e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 308
AccB1I GGYRCC 1 cut(s) 143
AccB7I CCANNNNNTGG 1 cut(s) 68
AccI GTMKAC 1 cut(s) 105
AclWI GGATC 1 cut(s) 260
AcsI RAATTY 1 cut(s) 245
AcuI CTGAAG 1 cut(s) 258
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 229
AhlI ACTAGT 2 cut(s) 125, 316
AjnI CCWGG 1 cut(s) 41
AjuI GAANNNNNNNTTGG 2 cut(s) 231, 263
AluBI AGCT 6 cut(s) 28, 58, 101, 223, 325, 353
AluI AGCT 6 cut(s) 28, 58, 101, 223, 325, 353
Alw26I GTCTC 1 cut(s) 316
AlwI GGATC 1 cut(s) 260
ApeKI GCWGC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 245
AspLEI GCGC 1 cut(s) 177
BanI GGYRCC 1 cut(s) 143
BbvI GCAGC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 316
BcuI ACTAGT 2 cut(s) 125, 316
BfaI CTAG 2 cut(s) 126, 317
BfmI CTRYAG 1 cut(s) 132
BfoI RGCGCY 1 cut(s) 178
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BmcAI AGTACT 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 145
BmrFI CCNGG 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 414, 444
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 43
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 422
BseXI GCAGC 1 cut(s) 110
BshNI GGYRCC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 316
Bsp143I GATC 2 cut(s) 265, 400
BspLI GGNNCC 1 cut(s) 145
BspMAI CTGCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 260
BspT107I GGYRCC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 62
BssMI GATC 2 cut(s) 265, 400
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 110
BstF5I GGATG 1 cut(s) 123
BstH2I RGCGCY 1 cut(s) 178
BstHHI GCGC 1 cut(s) 177
BstKTI GATC 2 cut(s) 268, 403
BstMAI GTCTC 1 cut(s) 316
BstMBI GATC 2 cut(s) 265, 400
BstMWI GCNNNNNNNGC 2 cut(s) 181, 291
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 41
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 123
CfoI GCGC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 129
CviAII CATG 2 cut(s) 282, 298
CviJI RGCY 7 cut(s) 28, 58, 101, 223, 325, 353, 420
CviKI_1 RGCY 7 cut(s) 28, 58, 101, 223, 325, 353, 420
CviQI GTAC 1 cut(s) 129
DpnI GATC 2 cut(s) 267, 402
DpnII GATC 2 cut(s) 265, 400
DrdI GACNNNNNNGTC 1 cut(s) 308
DseDI GACNNNNNNGTC 1 cut(s) 308
Eco57I CTGAAG 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 41
FaeI CATG 2 cut(s) 285, 301
FaiI YATR 6 cut(s) 88, 283, 299, 308, 338, 389
FalI AAGNNNNNCTT 4 cut(s) 67, 99, 161, 193
FatI CATG 2 cut(s) 281, 297
FblI GTMKAC 1 cut(s) 105
Fnu4HI GCNGC 1 cut(s) 99
FokI GGATG 1 cut(s) 130
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 2 cut(s) 126, 317
GlaI GCGC 1 cut(s) 176
GluI GCNGC 1 cut(s) 99
HaeII RGCGCY 1 cut(s) 178
HhaI GCGC 1 cut(s) 177
Hin1II CATG 2 cut(s) 285, 301
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 2 cut(s) 323, 351
HinfI GANTC 1 cut(s) 287
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 238, 400
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 1 cut(s) 106
Hpy99I CGWCG 2 cut(s) 110, 408
HpyAV CCTTC 2 cut(s) 69, 157
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 2 cut(s) 52, 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 181, 291
Hsp92II CATG 2 cut(s) 285, 301
HspAI GCGC 1 cut(s) 175
Kzo9I GATC 2 cut(s) 265, 400
LmnI GCTCC 1 cut(s) 389
LpnPI CCDG 4 cut(s) 28, 55, 75, 100
Lsp1109I GCAGC 1 cut(s) 110
MaeI CTAG 2 cut(s) 126, 317
MaeIII GTNAC 2 cut(s) 110, 440
MalI GATC 2 cut(s) 267, 402
MboI GATC 2 cut(s) 265, 400
MboII GAAGA 2 cut(s) 251, 254
MluCI AATT 3 cut(s) 12, 245, 425
MmeI TCCRAC 1 cut(s) 324
MnlI CCTC 4 cut(s) 165, 305, 401, 443
MspA1I CMGCKG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 43
MvaI CCWGG 1 cut(s) 43
MwoI GCNNNNNNNGC 2 cut(s) 181, 291
NdeII GATC 2 cut(s) 265, 400
NlaIII CATG 2 cut(s) 285, 301
NlaIV GGNNCC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 287
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 145
PstI CTGCAG 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 101
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SalI GTCGAC 1 cut(s) 104
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 265, 400
ScaI AGTACT 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 43
SetI ASST 7 cut(s) 30, 60, 103, 149, 225, 327, 355
SfcI CTRYAG 1 cut(s) 132
SpeI ACTAGT 2 cut(s) 125, 316
Sse9I AATT 3 cut(s) 12, 245, 425
SspMI CTAG 2 cut(s) 126, 317
StyD4I CCNGG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 110
TaqI TCGA 3 cut(s) 105, 257, 406
TasI AATT 3 cut(s) 12, 245, 425
TatI WGTACW 1 cut(s) 128
TfiI GAWTC 1 cut(s) 287
TseI GCWGC 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 75, 134
TspGWI ACGGA 1 cut(s) 427
Van91I CCANNNNNTGG 1 cut(s) 68
XapI RAATTY 1 cut(s) 245
XmiI GTMKAC 1 cut(s) 105
XspI CTAG 2 cut(s) 126, 317
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.