AT4G29035

rejection of self pollen

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0000965
Physical Location & Seq
Forward (+)
14310315 .. 14310770
456 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G29035.1

Sequence Viewer

Length: 456 bp
ATGAATTACATCAAACAATTTATCTTGGCAATTTGCTTTTATCTAGTCTTAACATGTCAAGATCATGTTTTAGCCCGCGACACCACCACGAGAGACATCGTAGTCCCGAAGATTTCCGAGTGGCAAGTTACGGTTGCTAACGGTTTGACCACTGGTGAAACTCTTTTCATCCATTGTAAGTCTAAGGAAAACGATCTAGGTGATATTAACCTGAAGTTCTTAGATAGATTTTCTTGGAATTTTGGAGAAAATATGCTTCACTCAACTTTGTTTTGGTGCTATATGAGCAAAGATGATGGTCATATGAATGTAAAAGTGTTTTGGGATGATGTTATTCTATTTCATAGATGTGATTGGAAGAATTGTGTTTGGACCGCAAAGAATGATGGCCTTTATCTTTGGAATTCTGCAATCGGTGAAGATGTACTGTCGGAGAAATGGAAATCTGGATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000003 GO:0007154 GO:0008150 GO:0009856 GO:0009875 GO:0009987 GO:0022414 GO:0032501 GO:0044706 GO:0051704
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

151

Amino Acids

17.75

Weight (kDa)

5.66

Isoelectric Point (pI)

21.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 42 - 147 1.4e-25 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 101
AccII CGCG 1 cut(s) 78
AciI CCGC 2 cut(s) 76, 375
AcsI RAATTY 2 cut(s) 238, 403
AcuI CTGAAG 1 cut(s) 233
AfaI GTAC 1 cut(s) 426
AflIII ACRYGT 1 cut(s) 53
Alw26I GTCTC 1 cut(s) 87
AoxI GGCC 1 cut(s) 388
ApoI RAATTY 2 cut(s) 238, 403
AspS9I GGNCC 1 cut(s) 372
AsuHPI GGTGA 3 cut(s) 167, 212, 428
AvaII GGWCC 1 cut(s) 372
BauI CACGAG 1 cut(s) 88
BccI CCATC 3 cut(s) 290, 380, 444
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 2 cut(s) 44, 197
Bme18I GGWCC 1 cut(s) 372
BmgT120I GGNCC 1 cut(s) 372
Bse1I ACTGG 1 cut(s) 157
BseGI GGATG 3 cut(s) 168, 331, 455
BseNI ACTGG 1 cut(s) 157
Bsh1236I CGCG 1 cut(s) 78
BshFI GGCC 1 cut(s) 390
BslFI GGGAC 1 cut(s) 89
BsmAI GTCTC 1 cut(s) 87
BsmFI GGGAC 1 cut(s) 89
BsnI GGCC 1 cut(s) 390
Bsp143I GATC 2 cut(s) 61, 193
BspACI CCGC 2 cut(s) 76, 375
BspANI GGCC 1 cut(s) 390
BspFNI CGCG 1 cut(s) 78
BsrI ACTGG 1 cut(s) 157
BssMI GATC 2 cut(s) 61, 193
BssSI CACGAG 1 cut(s) 88
Bst2BI CACGAG 1 cut(s) 88
Bst4CI ACNGT 3 cut(s) 133, 143, 429
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 2 cut(s) 183, 220
BstF5I GGATG 3 cut(s) 168, 331, 455
BstFNI CGCG 1 cut(s) 78
BstKTI GATC 2 cut(s) 64, 196
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 2 cut(s) 61, 193
BstMWI GCNNNNNNNGC 1 cut(s) 285
BstNSI RCATGY 1 cut(s) 57
BstUI CGCG 1 cut(s) 78
BsuRI GGCC 1 cut(s) 390
BtsCI GGATG 3 cut(s) 168, 331, 455
BtsIMutI CAGTG 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 372
Csp6I GTAC 1 cut(s) 425
CviAII CATG 2 cut(s) 54, 65
CviJI RGCY 2 cut(s) 74, 390
CviKI_1 RGCY 2 cut(s) 74, 390
CviQI GTAC 1 cut(s) 425
DdeI CTNAG 2 cut(s) 183, 220
DpnI GATC 2 cut(s) 63, 195
DpnII GATC 2 cut(s) 61, 193
DrdI GACNNNNNNGTC 1 cut(s) 101
DseDI GACNNNNNNGTC 1 cut(s) 101
Eco47I GGWCC 1 cut(s) 372
Eco57I CTGAAG 1 cut(s) 233
EcoRI GAATTC 1 cut(s) 403
FaeI CATG 2 cut(s) 57, 68
FaiI YATR 8 cut(s) 55, 66, 254, 282, 284, 303, 305, 345
FaqI GGGAC 1 cut(s) 89
FatI CATG 2 cut(s) 53, 64
FauI CCCGC 1 cut(s) 83
FauNDI CATATG 1 cut(s) 303
FokI GGATG 2 cut(s) 155, 338
FspBI CTAG 2 cut(s) 44, 197
HaeIII GGCC 1 cut(s) 390
Hin1II CATG 2 cut(s) 57, 68
HphI GGTGA 3 cut(s) 167, 212, 428
Hpy188I TCNGA 2 cut(s) 118, 433
Hpy188III TCNNGA 3 cut(s) 59, 106, 447
HpyCH4III ACNGT 3 cut(s) 133, 143, 429
HpyCH4V TGCA 1 cut(s) 410
HpyF10VI GCNNNNNNNGC 1 cut(s) 285
HpyF3I CTNAG 2 cut(s) 183, 220
Hsp92II CATG 2 cut(s) 57, 68
Kzo9I GATC 2 cut(s) 61, 193
LpnPI CCDG 3 cut(s) 138, 224, 432
MaeI CTAG 2 cut(s) 44, 197
MaeIII GTNAC 1 cut(s) 127
MalI GATC 2 cut(s) 63, 195
MboI GATC 2 cut(s) 61, 193
MboII GAAGA 3 cut(s) 121, 370, 431
MluCI AATT 6 cut(s) 4, 17, 30, 238, 361, 403
MmeI TCCRAC 1 cut(s) 411
MseI TTAA 2 cut(s) 50, 207
MslI CAYNNNNRTG 2 cut(s) 306, 348
MvnI CGCG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 285
NdeI CATATG 1 cut(s) 303
NdeII GATC 2 cut(s) 61, 193
NlaIII CATG 2 cut(s) 57, 68
NspI RCATGY 1 cut(s) 57
PciI ACATGT 1 cut(s) 53
PscI ACATGT 1 cut(s) 53
PspPI GGNCC 1 cut(s) 372
RsaI GTAC 1 cut(s) 426
RsaNI GTAC 1 cut(s) 425
RseI CAYNNNNRTG 2 cut(s) 306, 348
SaqAI TTAA 2 cut(s) 50, 207
Sau3AI GATC 2 cut(s) 61, 193
Sau96I GGNCC 1 cut(s) 372
SetI ASST 2 cut(s) 202, 213
SinI GGWCC 1 cut(s) 372
SmiMI CAYNNNNRTG 2 cut(s) 306, 348
Sse9I AATT 6 cut(s) 4, 17, 30, 238, 361, 403
SsiI CCGC 2 cut(s) 76, 375
SspMI CTAG 2 cut(s) 44, 197
TaaI ACNGT 3 cut(s) 133, 143, 429
TasI AATT 6 cut(s) 4, 17, 30, 238, 361, 403
TatI WGTACW 1 cut(s) 424
Tru1I TTAA 2 cut(s) 50, 207
Tru9I TTAA 2 cut(s) 50, 207
TscAI CASTG 1 cut(s) 157
TspDTI ATGAA 4 cut(s) 17, 157, 320, 332
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 372
XapI RAATTY 2 cut(s) 238, 403
XceI RCATGY 1 cut(s) 57
XspI CTAG 2 cut(s) 44, 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.