MD05G1181800.v1.1

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0000965
Physical Location & Seq
Forward (+)
31035202 .. 31035522
321 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1181800.v1.1.491

Sequence Viewer

Length: 321 bp
ATGGGGGCTTCAAGAACATTGGTAGCTCATTGTGAATCCCTAGATGATGACCTCGGAATTCGAGACATTTCAGCTGGGAATGAATTCAATTGGAGTTTCAGAGAGAACCTCTCTGGAAGTACGTTGTACTGGTGCGACATGCACAACGACCACCAGTACGCTTCCTTTAAGGTGTTTTGGCCAGAGAGTAACCACAGTTGGCTTCGCTACAGATGCAACTATAAAGAGTGCTTTTGGATTGCTAAAGATGATGGGATTTATCTACGAGTCATTCTTGAAAGTCGTGACGAGTTTCAGCTTAAATGGGAACCAGGGTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

107

Amino Acids

12.71

Weight (kDa)

5.05

Isoelectric Point (pI)

34.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 2 - 102 2.5e-22 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 179
AcsI RAATTY 2 cut(s) 57, 83
AfaI GTAC 3 cut(s) 121, 128, 158
AgsI TTSAA 3 cut(s) 12, 88, 278
AjnI CCWGG 1 cut(s) 310
AluBI AGCT 3 cut(s) 26, 74, 298
AluI AGCT 3 cut(s) 26, 74, 298
Alw26I GTCTC 1 cut(s) 57
AoxI GGCC 1 cut(s) 179
ApoI RAATTY 2 cut(s) 57, 83
Asp700I GAANNNNTTC 1 cut(s) 83
BalI TGGCCA 1 cut(s) 181
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 1 cut(s) 312
BcoDI GTCTC 1 cut(s) 57
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 312
BmiI GGNNCC 1 cut(s) 309
BmrFI CCNGG 1 cut(s) 312
BmsI GCATC 1 cut(s) 203
BplI GAGNNNNNCTC 4 cut(s) 93, 125, 95, 127
BsaJI CCNNGG 2 cut(s) 52, 311
Bse1I ACTGG 2 cut(s) 134, 154
BseBI CCWGG 1 cut(s) 312
BseDI CCNNGG 2 cut(s) 52, 311
BseNI ACTGG 2 cut(s) 134, 154
BseYI CCCAGC 1 cut(s) 74
BshFI GGCC 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 57
BsnI GGCC 1 cut(s) 181
BspANI GGCC 1 cut(s) 181
BspLI GGNNCC 1 cut(s) 309
BsrI ACTGG 2 cut(s) 134, 154
BssECI CCNNGG 2 cut(s) 52, 311
Bst2UI CCWGG 1 cut(s) 312
Bst4CI ACNGT 1 cut(s) 197
BstMAI GTCTC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 213
BstNI CCWGG 1 cut(s) 312
BstNSI RCATGY 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 310
BstSFI CTRYAG 1 cut(s) 208
BsuRI GGCC 1 cut(s) 181
Csp6I GTAC 3 cut(s) 120, 127, 157
CviAII CATG 1 cut(s) 139
CviJI RGCY 6 cut(s) 8, 26, 74, 181, 202, 298
CviKI_1 RGCY 6 cut(s) 8, 26, 74, 181, 202, 298
CviQI GTAC 3 cut(s) 120, 127, 157
EaeI YGGCCR 1 cut(s) 179
EcoRI GAATTC 2 cut(s) 57, 83
EcoRII CCWGG 1 cut(s) 310
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 140, 222
FatI CATG 1 cut(s) 138
FspBI CTAG 1 cut(s) 41
GsaI CCCAGC 1 cut(s) 78
HaeIII GGCC 1 cut(s) 181
Hin1II CATG 1 cut(s) 142
HinfI GANTC 2 cut(s) 35, 267
Hpy188I TCNGA 2 cut(s) 56, 101
Hpy188III TCNNGA 5 cut(s) 12, 62, 114, 275, 284
HpyCH4III ACNGT 1 cut(s) 197
HpyCH4IV ACGT 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 142, 216
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
HpySE526I ACGT 1 cut(s) 122
Hsp92II CATG 1 cut(s) 142
LpnPI CCDG 6 cut(s) 60, 99, 115, 167, 195, 297
LweI GCATC 1 cut(s) 203
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 122
MaeIII GTNAC 2 cut(s) 188, 284
MfeI CAATTG 1 cut(s) 88
MlsI TGGCCA 1 cut(s) 181
MluCI AATT 3 cut(s) 57, 83, 88
MluNI TGGCCA 1 cut(s) 181
MlyI GAGTC 1 cut(s) 276
MnlI CCTC 2 cut(s) 62, 119
Mox20I TGGCCA 1 cut(s) 181
MroXI GAANNNNTTC 1 cut(s) 83
MscI TGGCCA 1 cut(s) 181
MseI TTAA 2 cut(s) 168, 300
Msp20I TGGCCA 1 cut(s) 181
MspA1I CMGCKG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 312
MunI CAATTG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 312
MwoI GCNNNNNNNGC 1 cut(s) 213
NlaIII CATG 1 cut(s) 142
NlaIV GGNNCC 1 cut(s) 309
NmuCI GTSAC 1 cut(s) 284
NspI RCATGY 1 cut(s) 142
PdmI GAANNNNTTC 1 cut(s) 83
PfeI GAWTC 1 cut(s) 35
PleI GAGTC 1 cut(s) 275
PpsI GAGTC 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 310
PspFI CCCAGC 1 cut(s) 74
PspGI CCWGG 1 cut(s) 310
PspN4I GGNNCC 1 cut(s) 309
PvuII CAGCTG 1 cut(s) 74
RsaI GTAC 3 cut(s) 121, 128, 158
RsaNI GTAC 3 cut(s) 120, 127, 157
SaqAI TTAA 2 cut(s) 168, 300
SchI GAGTC 1 cut(s) 276
ScrFI CCNGG 1 cut(s) 312
SetI ASST 7 cut(s) 28, 54, 76, 111, 125, 174, 300
SfaNI GCATC 1 cut(s) 203
SfcI CTRYAG 1 cut(s) 208
Sse9I AATT 3 cut(s) 57, 83, 88
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 310
TaaI ACNGT 1 cut(s) 197
TaiI ACGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 61
TasI AATT 3 cut(s) 57, 83, 88
TatI WGTACW 1 cut(s) 126
TfiI GAWTC 1 cut(s) 35
Tru1I TTAA 2 cut(s) 168, 300
Tru9I TTAA 2 cut(s) 168, 300
TseFI GTSAC 1 cut(s) 284
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 96
XapI RAATTY 2 cut(s) 57, 83
XceI RCATGY 1 cut(s) 142
XmnI GAANNNNTTC 1 cut(s) 83
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.