Rmu_sc0010577.1_g000002

Plant self-incompatibility protein S1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010577.1
Physical Location & Seq
Forward (+)
2326 .. 2754
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010577.1_g000002.1.cds

Sequence Viewer

Length: 429 bp
atgagtggtttcaagctctatgaggttgcgcttgtgtctttaacaatcttagccttgactatcccatgttttgctgtgacgtggcatgttcacgtcgtcaatggattgagttctggaagaattctcttcgtccattgcaagtctaaagataatgatctcggcatccataatcttgcagtcggaaccgaaaccacttggagtttcaaagaaaacttcatagggacaacacttttttggtgctacctacgcacagaccgtgaagagtatgctgattttgatgtgttctggtcggagcataatcgcaagtggcttcagaccagatgcaactggaaagattgcatatggaccgcaagagatgacggggtttacataaagaacattcctaacaacagtgatgagcttattcatcaatggggaacgcattggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

16.66

Weight (kDa)

6.13

Isoelectric Point (pI)

20.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 348
AcsI RAATTY 1 cut(s) 120
AcuI CTGAAG 1 cut(s) 296
AgsI TTSAA 2 cut(s) 13, 205
AjiI CACGTC 2 cut(s) 81, 94
AluBI AGCT 2 cut(s) 16, 400
AluI AGCT 2 cut(s) 16, 400
ApoI RAATTY 1 cut(s) 120
AspLEI GCGC 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 345
AvaII GGWCC 1 cut(s) 345
Bme18I GGWCC 1 cut(s) 345
BmgBI CACGTC 2 cut(s) 81, 94
BmgT120I GGNCC 1 cut(s) 345
BmiI GGNNCC 1 cut(s) 184
BmsI GCATC 2 cut(s) 171, 311
BsaBI GATNNNNATC 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 332
Bse3DI GCAATG 1 cut(s) 133
Bse8I GATNNNNATC 1 cut(s) 153
BseGI GGATG 1 cut(s) 162
BseJI GATNNNNATC 1 cut(s) 153
BseMI GCAATG 1 cut(s) 133
BseNI ACTGG 1 cut(s) 332
BslFI GGGAC 1 cut(s) 235
BsmFI GGGAC 1 cut(s) 235
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 1 cut(s) 348
BspLI GGNNCC 1 cut(s) 184
BsrDI GCAATG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 332
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 257, 392
Bst6I CTCTTC 2 cut(s) 131, 255
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 162
BstHHI GCGC 1 cut(s) 31
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 1 cut(s) 246
BstNSI RCATGY 1 cut(s) 89
BtrI CACGTC 2 cut(s) 81, 94
BtsCI GGATG 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 397
CfoI GCGC 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 345
CviAII CATG 2 cut(s) 66, 86
CviJI RGCY 4 cut(s) 16, 53, 310, 400
CviKI_1 RGCY 4 cut(s) 16, 53, 310, 400
DdeI CTNAG 1 cut(s) 49
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eam1104I CTCTTC 2 cut(s) 131, 255
EarI CTCTTC 2 cut(s) 131, 255
Eco47I GGWCC 1 cut(s) 345
Eco57I CTGAAG 1 cut(s) 296
EcoRI GAATTC 1 cut(s) 120
FaeI CATG 2 cut(s) 69, 89
FaqI GGGAC 1 cut(s) 235
FatI CATG 2 cut(s) 65, 85
FauNDI CATATG 1 cut(s) 341
FokI GGATG 1 cut(s) 149
GlaI GCGC 1 cut(s) 30
HhaI GCGC 1 cut(s) 31
Hin1II CATG 2 cut(s) 69, 89
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
Hpy166II GTNNAC 2 cut(s) 91, 367
Hpy188I TCNGA 3 cut(s) 182, 292, 315
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 2 cut(s) 91, 367
Hpy99I CGWCG 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 257, 392
HpyCH4IV ACGT 2 cut(s) 80, 93
HpyCH4V TGCA 4 cut(s) 138, 176, 324, 339
HpyF10VI GCNNNNNNNGC 1 cut(s) 246
HpyF3I CTNAG 1 cut(s) 49
HpySE526I ACGT 2 cut(s) 80, 93
Hsp92II CATG 2 cut(s) 69, 89
HspAI GCGC 1 cut(s) 29
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 292
LpnPI CCDG 4 cut(s) 99, 271, 313, 331
LweI GCATC 2 cut(s) 171, 311
MaeII ACGT 2 cut(s) 80, 93
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 3 cut(s) 118, 129, 272
MluCI AATT 1 cut(s) 120
MmeI TCCRAC 2 cut(s) 160, 270
MnlI CCTC 1 cut(s) 16
MseI TTAA 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 246
NdeI CATATG 1 cut(s) 341
NdeII GATC 1 cut(s) 154
NlaIII CATG 2 cut(s) 69, 89
NlaIV GGNNCC 1 cut(s) 184
NmeAIII GCCGAG 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 76
NspI RCATGY 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 253
PspN4I GGNNCC 1 cut(s) 184
PspPI GGNCC 1 cut(s) 345
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 345
SetI ASST 6 cut(s) 18, 27, 83, 96, 246, 402
SfaNI GCATC 2 cut(s) 171, 311
SinI GGWCC 1 cut(s) 345
Sse9I AATT 1 cut(s) 120
SsiI CCGC 1 cut(s) 348
TaaI ACNGT 2 cut(s) 257, 392
TaiI ACGT 2 cut(s) 83, 96
TasI AATT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TscAI CASTG 1 cut(s) 397
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 2 cut(s) 205, 395
TspRI CASTG 1 cut(s) 397
VpaK11BI GGWCC 1 cut(s) 345
XapI RAATTY 1 cut(s) 120
XceI RCATGY 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.