Rmu_sc0011217.1_g000016

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011217.1
OG0000965
Physical Location & Seq
Reverse (-)
47422 .. 47901
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011217.1_g000016.1.cds

Sequence Viewer

Length: 480 bp
atgagcattagtatgaagcactctattgtttttttaatctctttggcaatactctcagccttgactggttgcggaaatactgctgagaacgatatccacgtgccgggtgtcgacaggtggtacgtgcacgttgtcaatggactcggggaaggtagatggctctttgttcattgccagtccaaagacgacgatctcggaactcatgatctagcaacagggaaggagttttggtggacgttcaagacaagttatttcgggcgcacacttttctggtgctacctgcggaccgacgaagccaccaacaaacaacatgctacttttgatgcgttttggcatgagaagcaccatttttggcttttggatcattgtggcgatgaagaaaggaattgcatctggactgcaaaagatgatgggatttacttgaaaatcaattctaaaaatgttgatgactttgttcataaatgggaaccaggttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

159

Amino Acids

18.58

Weight (kDa)

5.82

Isoelectric Point (pI)

27.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 288
AccI GTMKAC 1 cut(s) 111
AciI CCGC 2 cut(s) 72, 283
AclWI GGATC 1 cut(s) 369
AcvI CACGTG 1 cut(s) 100
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 103
AgsI TTSAA 2 cut(s) 241, 424
AjnI CCWGG 1 cut(s) 469
Alw21I GWGCWC 1 cut(s) 129
Alw44I GTGCAC 1 cut(s) 125
AlwI GGATC 1 cut(s) 369
Ama87I CYCGRG 1 cut(s) 143
ApaLI GTGCAC 1 cut(s) 125
AspLEI GCGC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 285
AsuC2I CCSGG 1 cut(s) 105
AvaI CYCGRG 1 cut(s) 143
AvaII GGWCC 1 cut(s) 285
BaeGI GKGCMC 1 cut(s) 129
BbrPI CACGTG 1 cut(s) 100
Bbv12I GWGCWC 1 cut(s) 129
BccI CCATC 2 cut(s) 150, 404
BciT130I CCWGG 1 cut(s) 471
BcnI CCSGG 1 cut(s) 105
BfaI CTAG 1 cut(s) 209
BfuAI ACCTGC 1 cut(s) 288
Bme1390I CCNGG 2 cut(s) 105, 471
Bme18I GGWCC 1 cut(s) 285
BmeT110I CYCGRG 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 285
BmiI GGNNCC 1 cut(s) 468
BmrFI CCNGG 2 cut(s) 105, 471
BmsI GCATC 2 cut(s) 313, 399
BpuMI CCSGG 1 cut(s) 105
BsaAI YACGTR 2 cut(s) 100, 124
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 2 cut(s) 70, 175
Bse3DI GCAATG 1 cut(s) 169
BseBI CCWGG 1 cut(s) 471
BseLI CCNNNNNNNGG 1 cut(s) 103
BseMI GCAATG 1 cut(s) 169
BseMII CTCAG 2 cut(s) 69, 75
BseNI ACTGG 2 cut(s) 70, 175
BseSI GKGCMC 1 cut(s) 129
BsiHKAI GWGCWC 1 cut(s) 129
BsiHKCI CYCGRG 1 cut(s) 143
BsiSI CCGG 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 103
BsoBI CYCGRG 1 cut(s) 143
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 3 cut(s) 190, 205, 361
BspACI CCGC 2 cut(s) 72, 283
BspCNI CTCAG 2 cut(s) 68, 76
BspHI TCATGA 1 cut(s) 202
BspLI GGNNCC 1 cut(s) 468
BspMI ACCTGC 1 cut(s) 288
BspPI GGATC 1 cut(s) 369
BsrDI GCAATG 1 cut(s) 169
BsrI ACTGG 2 cut(s) 70, 175
BssMI GATC 3 cut(s) 190, 205, 361
Bst2UI CCWGG 1 cut(s) 471
BstBAI YACGTR 2 cut(s) 100, 124
BstDEI CTNAG 2 cut(s) 55, 84
BstHHI GCGC 1 cut(s) 261
BstKTI GATC 3 cut(s) 193, 208, 364
BstMBI GATC 3 cut(s) 190, 205, 361
BstMWI GCNNNNNNNGC 1 cut(s) 340
BstNI CCWGG 1 cut(s) 471
BstNSI RCATGY 1 cut(s) 314
BstSCI CCNGG 2 cut(s) 103, 469
BstSLI GKGCMC 1 cut(s) 129
BtgZI GCGATG 1 cut(s) 387
BveI ACCTGC 1 cut(s) 288
CciI TCATGA 1 cut(s) 202
CfoI GCGC 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 285
CpoI CGGWCCG 1 cut(s) 285
CsiI ACCWGGT 1 cut(s) 469
Csp6I GTAC 1 cut(s) 121
CspI CGGWCCG 1 cut(s) 285
CviAII CATG 3 cut(s) 203, 311, 335
CviJI RGCY 4 cut(s) 59, 160, 296, 355
CviKI_1 RGCY 4 cut(s) 59, 160, 296, 355
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 2 cut(s) 55, 84
DpnI GATC 3 cut(s) 192, 207, 363
DpnII GATC 3 cut(s) 190, 205, 361
Eco32I GATATC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 285
Eco72I CACGTG 1 cut(s) 100
Eco88I CYCGRG 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 469
EcoRV GATATC 1 cut(s) 94
FaeI CATG 3 cut(s) 206, 314, 338
FaiI YATR 5 cut(s) 14, 204, 312, 336, 459
FatI CATG 3 cut(s) 202, 310, 334
FblI GTMKAC 1 cut(s) 111
FspBI CTAG 1 cut(s) 209
GlaI GCGC 1 cut(s) 260
HapII CCGG 1 cut(s) 104
HhaI GCGC 1 cut(s) 261
Hin1II CATG 3 cut(s) 206, 314, 338
Hin6I GCGC 1 cut(s) 259
HinP1I GCGC 1 cut(s) 259
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HinfI GANTC 1 cut(s) 141
HpaII CCGG 1 cut(s) 104
Hpy166II GTNNAC 3 cut(s) 112, 127, 234
Hpy188I TCNGA 1 cut(s) 197
Hpy188III TCNNGA 3 cut(s) 203, 241, 394
Hpy8I GTNNAC 3 cut(s) 112, 127, 234
Hpy99I CGWCG 2 cut(s) 191, 293
HpyAV CCTTC 2 cut(s) 143, 214
HpyCH4IV ACGT 4 cut(s) 99, 123, 129, 236
HpyCH4V TGCA 3 cut(s) 127, 390, 401
HpyF10VI GCNNNNNNNGC 1 cut(s) 340
HpyF3I CTNAG 2 cut(s) 55, 84
HpySE526I ACGT 4 cut(s) 99, 123, 129, 236
Hsp92II CATG 3 cut(s) 206, 314, 338
HspAI GCGC 1 cut(s) 259
Kzo9I GATC 3 cut(s) 190, 205, 361
LpnPI CCDG 9 cut(s) 51, 100, 117, 188, 201, 256, 293, 379, 456
LweI GCATC 2 cut(s) 313, 399
MabI ACCWGGT 1 cut(s) 469
MaeI CTAG 1 cut(s) 209
MaeII ACGT 4 cut(s) 99, 123, 129, 236
MalI GATC 3 cut(s) 192, 207, 363
MboI GATC 3 cut(s) 190, 205, 361
MboII GAAGA 1 cut(s) 389
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 2 cut(s) 385, 430
MlyI GAGTC 1 cut(s) 135
MseI TTAA 1 cut(s) 35
MslI CAYNNNNRTG 1 cut(s) 11
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 2 cut(s) 105, 471
MvaI CCWGG 1 cut(s) 471
MwoI GCNNNNNNNGC 1 cut(s) 340
NciI CCSGG 1 cut(s) 105
NdeII GATC 3 cut(s) 190, 205, 361
NlaIII CATG 3 cut(s) 206, 314, 338
NlaIV GGNNCC 1 cut(s) 468
NspI RCATGY 1 cut(s) 314
PagI TCATGA 1 cut(s) 202
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PleI GAGTC 1 cut(s) 135
PmaCI CACGTG 1 cut(s) 100
PmlI CACGTG 1 cut(s) 100
PpsI GAGTC 1 cut(s) 135
Ppu21I YACGTR 2 cut(s) 100, 124
Psp6I CCWGG 1 cut(s) 469
PspCI CACGTG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 469
PspN4I GGNNCC 1 cut(s) 468
PspPI GGNCC 1 cut(s) 285
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 11
Rsr2I CGGWCCG 1 cut(s) 285
RsrII CGGWCCG 1 cut(s) 285
SalI GTCGAC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 35
Sau3AI GATC 3 cut(s) 190, 205, 361
Sau96I GGNCC 1 cut(s) 285
SchI GAGTC 1 cut(s) 135
ScrFI CCNGG 2 cut(s) 105, 471
SduI GDGCHC 1 cut(s) 129
SetI ASST 8 cut(s) 102, 119, 126, 132, 154, 239, 282, 475
SexAI ACCWGGT 1 cut(s) 469
SfaNI GCATC 2 cut(s) 313, 399
SinI GGWCC 1 cut(s) 285
SmiMI CAYNNNNRTG 1 cut(s) 11
Sse9I AATT 2 cut(s) 385, 430
SsiI CCGC 2 cut(s) 72, 283
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 2 cut(s) 103, 469
TaiI ACGT 4 cut(s) 102, 126, 132, 239
TaqI TCGA 1 cut(s) 111
TaqII GACCGA 1 cut(s) 302
TasI AATT 2 cut(s) 385, 430
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TspDTI ATGAA 4 cut(s) 29, 158, 390, 446
VneI GTGCAC 1 cut(s) 125
VpaK11BI GGWCC 1 cut(s) 285
XceI RCATGY 1 cut(s) 314
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.