Rw6G024530

Plant self-incompatibility protein S1

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Forward (+)
47696600 .. 47697025
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G024530.1

Sequence Viewer

Length: 321 bp
ATGAGTGATTTCAAGGTCCATGTGGTTGTGCTTGTGTCTTTAGCATTCTTAGCCTTAAGTATCCCATTGCCTGCTTCTAAAGATAATGACCTTGGCACCCATAATCTTGCAGTCGGAACCAAAACCACTTGGAGTTTCAGAGAAAACTTAATGTGGACAACACTTCTCTGGTGCTACCTGCGCACAGACTATGAAGAGTACGCCAGTTTTGATATATGCAACTGGAAAGATTGCATATGGATTGCAACAAATAAGGTTTACATAAAGTACATTTCTAACGACAATGATGAGCTTATTCATCAATGGGGAACGCACTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.36

Weight (kDa)

5.37

Isoelectric Point (pI)

18.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 26 - 102 1e-09 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 182
Acc36I ACCTGC 1 cut(s) 186
AccB1I GGYRCC 1 cut(s) 95
AfaI GTAC 2 cut(s) 200, 269
AflII CTTAAG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 1 cut(s) 292
AluI AGCT 1 cut(s) 292
AspLEI GCGC 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 16
AvaII GGWCC 1 cut(s) 16
BanI GGYRCC 1 cut(s) 95
BciVI GTATCC 1 cut(s) 71
BfrI CTTAAG 1 cut(s) 55
BfuAI ACCTGC 1 cut(s) 186
BfuI GTATCC 1 cut(s) 71
Bme18I GGWCC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 16
BmiI GGNNCC 2 cut(s) 97, 118
BsaJI CCNNGG 1 cut(s) 91
Bse1I ACTGG 2 cut(s) 204, 227
Bse3DI GCAATG 1 cut(s) 65
BseDI CCNNGG 1 cut(s) 91
BseMI GCAATG 1 cut(s) 65
BseNI ACTGG 2 cut(s) 204, 227
BshNI GGYRCC 1 cut(s) 95
BsmI GAATGC 1 cut(s) 44
BspLI GGNNCC 2 cut(s) 97, 118
BspMI ACCTGC 1 cut(s) 186
BspT107I GGYRCC 1 cut(s) 95
BspTI CTTAAG 1 cut(s) 55
BsrDI GCAATG 1 cut(s) 65
BsrI ACTGG 2 cut(s) 204, 227
BssECI CCNNGG 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 317
Bst6I CTCTTC 1 cut(s) 189
BstAFI CTTAAG 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 49
BstHHI GCGC 1 cut(s) 183
BstMWI GCNNNNNNNGC 2 cut(s) 50, 180
BsuI GTATCC 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 313
BveI ACCTGC 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 72
CfoI GCGC 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 16
Csp6I GTAC 2 cut(s) 199, 268
CviAII CATG 1 cut(s) 20
CviJI RGCY 2 cut(s) 53, 292
CviKI_1 RGCY 2 cut(s) 53, 292
CviQI GTAC 2 cut(s) 199, 268
DdeI CTNAG 1 cut(s) 49
Eam1104I CTCTTC 1 cut(s) 189
EarI CTCTTC 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 16
EcoT14I CCWWGG 1 cut(s) 91
ErhI CCWWGG 1 cut(s) 91
FaeI CATG 1 cut(s) 23
FaiI YATR 8 cut(s) 21, 102, 192, 215, 217, 236, 238, 263
FatI CATG 1 cut(s) 19
FauNDI CATATG 1 cut(s) 236
FspI TGCGCA 1 cut(s) 182
GlaI GCGC 1 cut(s) 182
HhaI GCGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 23
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
Hpy166II GTNNAC 2 cut(s) 156, 259
Hpy188I TCNGA 2 cut(s) 116, 140
Hpy8I GTNNAC 2 cut(s) 156, 259
HpyCH4III ACNGT 1 cut(s) 317
HpyCH4V TGCA 4 cut(s) 110, 219, 234, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 50, 180
HpyF3I CTNAG 1 cut(s) 49
Hsp92II CATG 1 cut(s) 23
HspAI GCGC 1 cut(s) 181
LpnPI CCDG 5 cut(s) 84, 154, 191, 208, 217
MboII GAAGA 1 cut(s) 206
MmeI TCCRAC 1 cut(s) 94
MseI TTAA 3 cut(s) 56, 149, 319
MspCI CTTAAG 1 cut(s) 55
Mva1269I GAATGC 1 cut(s) 44
MwoI GCNNNNNNNGC 2 cut(s) 50, 180
NdeI CATATG 1 cut(s) 236
NlaIII CATG 1 cut(s) 23
NlaIV GGNNCC 2 cut(s) 97, 118
NsbI TGCGCA 1 cut(s) 182
PctI GAATGC 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 97, 118
PspPI GGNCC 1 cut(s) 16
RsaI GTAC 2 cut(s) 200, 269
RsaNI GTAC 2 cut(s) 199, 268
SaqAI TTAA 3 cut(s) 56, 149, 319
Sau96I GGNCC 1 cut(s) 16
SetI ASST 5 cut(s) 18, 93, 180, 258, 294
SinI GGWCC 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 55
SmoI CTYRAG 1 cut(s) 55
StyI CCWWGG 1 cut(s) 91
TaaI ACNGT 1 cut(s) 317
TatI WGTACW 1 cut(s) 267
Tru1I TTAA 3 cut(s) 56, 149, 319
Tru9I TTAA 3 cut(s) 56, 149, 319
TscAI CASTG 1 cut(s) 320
TspDTI ATGAA 2 cut(s) 207, 287
TspRI CASTG 1 cut(s) 320
Vha464I CTTAAG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.