MD07G1033500.v1.1

disease resistance

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
2754781 .. 2755206
426 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1033500.v1.1.491

Sequence Viewer

Length: 348 bp
ATGTATAAATGTCAGAGTCATCTTGTCTTGAAAGAGGAGGAAGAGGAGATAGAGGGGTCTTCGTTATCTTCTTCCCATTGTCGGAGGAAAGAGGAGGCATCTTGTCTTGAAACTATGGCGATAGTGGACTGTCCATCAATAACTTCCTTTTCATCCAAAGGACAGTTATCTTTACCAGCTCTTAAACACCTTGAAGTGAGTAATTGCTACCAACTGGAGTCAATAAGCGATAGCTTATTGTGGGATAACACTTGTTTCGAATTCATTGATATCTATGATTGTGAAAACCTTAAATCCCTACCCAAGGGCCTATGCCACCTGACCAGTCTTCGGTTTTTCTATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.12

Weight (kDa)

4.87

Isoelectric Point (pI)

68.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 260
AfiI CCNNNNNNNGG 3 cut(s) 81, 304, 330
AgsI TTSAA 3 cut(s) 31, 110, 194
AluBI AGCT 2 cut(s) 179, 234
AluI AGCT 2 cut(s) 179, 234
AoxI GGCC 1 cut(s) 307
ApoI RAATTY 1 cut(s) 260
AspS9I GGNCC 1 cut(s) 307
AsuII TTCGAA 1 cut(s) 258
BbsI GAAGAC 2 cut(s) 51, 320
BccI CCATC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 307
BmsI GCATC 1 cut(s) 107
BpiI GAAGAC 2 cut(s) 51, 320
BpmI CTGGAG 1 cut(s) 236
Bpu14I TTCGAA 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 303
Bsc4I CCNNNNNNNGG 3 cut(s) 81, 304, 330
Bse1I ACTGG 2 cut(s) 219, 324
BseDI CCNNGG 1 cut(s) 303
BseGI GGATG 1 cut(s) 152
BseLI CCNNNNNNNGG 3 cut(s) 81, 304, 330
BseNI ACTGG 2 cut(s) 219, 324
BseRI GAGGAG 3 cut(s) 50, 59, 107
BshFI GGCC 1 cut(s) 309
BslI CCNNNNNNNGG 3 cut(s) 81, 304, 330
BsnI GGCC 1 cut(s) 309
Bsp119I TTCGAA 1 cut(s) 258
BspANI GGCC 1 cut(s) 309
BspT104I TTCGAA 1 cut(s) 258
BsrI ACTGG 2 cut(s) 219, 324
BssECI CCNNGG 1 cut(s) 303
BssT1I CCWWGG 1 cut(s) 303
Bst4CI ACNGT 2 cut(s) 131, 165
Bst6I CTCTTC 1 cut(s) 36
BstBI TTCGAA 1 cut(s) 258
BstENI CCTNNNNNAGG 1 cut(s) 302
BstF5I GGATG 1 cut(s) 152
BstV2I GAAGAC 2 cut(s) 51, 320
BsuRI GGCC 1 cut(s) 309
BtsCI GGATG 1 cut(s) 152
Cfr13I GGNCC 1 cut(s) 307
CviJI RGCY 3 cut(s) 179, 234, 309
CviKI_1 RGCY 3 cut(s) 179, 234, 309
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 303
Eco32I GATATC 1 cut(s) 271
EcoNI CCTNNNNNAGG 1 cut(s) 302
EcoO109I RGGNCCY 1 cut(s) 307
EcoRI GAATTC 1 cut(s) 260
EcoRV GATATC 1 cut(s) 271
EcoT14I CCWWGG 1 cut(s) 303
ErhI CCWWGG 1 cut(s) 303
FaiI YATR 4 cut(s) 6, 116, 276, 313
FokI GGATG 1 cut(s) 139
GsuI CTGGAG 1 cut(s) 236
HaeIII GGCC 1 cut(s) 309
HinfI GANTC 2 cut(s) 16, 218
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 2 cut(s) 15, 84
Hpy188III TCNNGA 2 cut(s) 28, 107
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4III ACNGT 2 cut(s) 131, 165
LpnPI CCDG 4 cut(s) 189, 200, 332, 337
LweI GCATC 1 cut(s) 107
MboII GAAGA 5 cut(s) 51, 53, 60, 63, 320
MluCI AATT 2 cut(s) 202, 260
MlyI GAGTC 2 cut(s) 25, 227
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 7 cut(s) 28, 31, 37, 46, 78, 85, 88
MseI TTAA 2 cut(s) 183, 291
NspV TTCGAA 1 cut(s) 258
PleI GAGTC 2 cut(s) 24, 226
PpsI GAGTC 2 cut(s) 24, 226
PspPI GGNCC 1 cut(s) 307
SaqAI TTAA 2 cut(s) 183, 291
Sau96I GGNCC 1 cut(s) 307
SchI GAGTC 2 cut(s) 25, 227
SetI ASST 5 cut(s) 181, 192, 236, 291, 321
SfaNI GCATC 1 cut(s) 107
SfuI TTCGAA 1 cut(s) 258
Sse9I AATT 2 cut(s) 202, 260
StyI CCWWGG 1 cut(s) 303
TaaI ACNGT 2 cut(s) 131, 165
TaqI TCGA 1 cut(s) 258
TasI AATT 2 cut(s) 202, 260
Tru1I TTAA 2 cut(s) 183, 291
Tru9I TTAA 2 cut(s) 183, 291
TspDTI ATGAA 2 cut(s) 141, 253
XagI CCTNNNNNAGG 1 cut(s) 302
XapI RAATTY 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.