Prupe.2G040600_v2.0.a1

disease resistance

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
4463221 .. 4464466
1246 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G040600.1

Sequence Viewer

Length: 405 bp
ATGTTTTGCTCTTGTAGTTCTAAAAACTTTACAATTGGTGGCAGGGGAAGTGACAATATCTTGGAGACGTTGCTCAAGCAACAGCTGCTTCCTACCACTCTTCACACTCAACGCATCAACGAAATTACAAGTCTGAAATCTTTGAACAGAAAGGGAAACCTCACTTCTCTCCAACACCTACGAATGGAAAGCTGTCCTACTCTCGAATTTCTGCAACTTCAACACCTCACTTCTCTTCAAAGGATTTATATTAGTTGGTGTGACAATCTCCAATTCATGCTAAAAGAGGGTTTGCAGCCATCTCTTTCTTTACTTCTGATCTACAAATGTTCTGGCCTAGAGAAAAGGTATGATAATAAGACGGGAAAAGATTGGGTTAACATATCTCAAATTCCTTACAGCTGA

Protein Analysis

135

Amino Acids

15.41

Weight (kDa)

9.06

Isoelectric Point (pI)

52.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 206, 390
AfiI CCNNNNNNNGG 1 cut(s) 184
AgsI TTSAA 3 cut(s) 145, 221, 239
AluBI AGCT 3 cut(s) 85, 192, 402
AluI AGCT 3 cut(s) 85, 192, 402
Alw26I GTCTC 1 cut(s) 59
AoxI GGCC 1 cut(s) 334
ApeKI GCWGC 2 cut(s) 85, 295
ApoI RAATTY 2 cut(s) 206, 390
BbvI GCAGC 2 cut(s) 72, 307
BccI CCATC 1 cut(s) 307
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 338
BisI GCNGC 2 cut(s) 86, 296
BlsI GCNGC 2 cut(s) 87, 297
BmsI GCATC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 59
Bsc4I CCNNNNNNNGG 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 184
BseXI GCAGC 2 cut(s) 72, 307
BshFI GGCC 1 cut(s) 336
BslI CCNNNNNNNGG 1 cut(s) 184
BsmAI GTCTC 1 cut(s) 59
BsmBI CGTCTC 1 cut(s) 59
BsnI GGCC 1 cut(s) 336
Bsp143I GATC 1 cut(s) 318
BspANI GGCC 1 cut(s) 336
BssMI GATC 1 cut(s) 318
Bst6I CTCTTC 2 cut(s) 105, 240
BstAPI GCANNNNNTGC 1 cut(s) 85
BstKTI GATC 1 cut(s) 321
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 1 cut(s) 318
BstMWI GCNNNNNNNGC 1 cut(s) 85
BstV1I GCAGC 2 cut(s) 72, 307
BsuRI GGCC 1 cut(s) 336
CviAII CATG 1 cut(s) 277
CviJI RGCY 5 cut(s) 85, 192, 298, 336, 402
CviKI_1 RGCY 5 cut(s) 85, 192, 298, 336, 402
DpnI GATC 1 cut(s) 320
DpnII GATC 1 cut(s) 318
Eam1104I CTCTTC 2 cut(s) 105, 240
EarI CTCTTC 2 cut(s) 105, 240
Esp3I CGTCTC 1 cut(s) 59
FaeI CATG 1 cut(s) 280
FaiI YATR 4 cut(s) 249, 278, 351, 383
FatI CATG 1 cut(s) 276
Fnu4HI GCNGC 2 cut(s) 86, 296
Fsp4HI GCNGC 2 cut(s) 86, 296
FspBI CTAG 1 cut(s) 338
GluI GCNGC 2 cut(s) 86, 296
HaeIII GGCC 1 cut(s) 336
Hin1II CATG 1 cut(s) 280
HincII GTYRAC 1 cut(s) 379
HindII GTYRAC 1 cut(s) 379
HpaI GTTAAC 1 cut(s) 379
Hpy166II GTNNAC 1 cut(s) 379
Hpy188I TCNGA 2 cut(s) 135, 318
Hpy188III TCNNGA 1 cut(s) 203
Hpy8I GTNNAC 1 cut(s) 379
HpyCH4IV ACGT 1 cut(s) 68
HpyCH4V TGCA 2 cut(s) 214, 295
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
HpySE526I ACGT 1 cut(s) 68
Hsp92II CATG 1 cut(s) 280
KspAI GTTAAC 1 cut(s) 379
Kzo9I GATC 1 cut(s) 318
LpnPI CCDG 2 cut(s) 28, 318
Lsp1109I GCAGC 2 cut(s) 72, 307
LweI GCATC 1 cut(s) 123
MaeI CTAG 1 cut(s) 338
MaeII ACGT 1 cut(s) 68
MaeIII GTNAC 2 cut(s) 50, 260
MalI GATC 1 cut(s) 320
MboI GATC 1 cut(s) 318
MboII GAAGA 2 cut(s) 92, 227
MfeI CAATTG 1 cut(s) 33
MluCI AATT 5 cut(s) 33, 123, 206, 272, 390
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 3 cut(s) 170, 236, 280
MseI TTAA 1 cut(s) 378
MspA1I CMGCKG 2 cut(s) 85, 402
MunI CAATTG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 85
NdeII GATC 1 cut(s) 318
NlaIII CATG 1 cut(s) 280
NmuCI GTSAC 2 cut(s) 50, 260
PkrI GCNGC 2 cut(s) 87, 297
PvuII CAGCTG 2 cut(s) 85, 402
SaqAI TTAA 1 cut(s) 378
SatI GCNGC 2 cut(s) 86, 296
Sau3AI GATC 1 cut(s) 318
SetI ASST 8 cut(s) 71, 87, 162, 180, 194, 228, 350, 404
SfaNI GCATC 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 5 cut(s) 33, 123, 206, 272, 390
SspMI CTAG 1 cut(s) 338
TaiI ACGT 1 cut(s) 71
TaqI TCGA 1 cut(s) 204
TasI AATT 5 cut(s) 33, 123, 206, 272, 390
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TseFI GTSAC 2 cut(s) 50, 260
TseI GCWGC 2 cut(s) 85, 295
Tsp45I GTSAC 2 cut(s) 50, 260
TspDTI ATGAA 1 cut(s) 265
XapI RAATTY 2 cut(s) 206, 390
XspI CTAG 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.