Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003145.1

Orthogroup ID

OG0001766

Physical Location & Seq

Genomic Coordinates Forward (+)

16548 .. 16946

Gene Structure 399 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003145.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

atggaatctcaagggttgcacagactcacctctttgagagaattgcggatctacggtggtagagatgatcgaggtctggtgtcctttccacctggtgagaattcgaaggagaaggagatgctgctcccccgatctcttgttgaattgacaattggattcttcccaaatctaaagaaactgagcaagggctttcaattcctcacctctcttgagtatcttcgcatctccagctgtccgaagctcacaaccattccagaggagggcctgcctctttcacttactcaacttgagattggtgggtgtcctctacttgaagagagatgcaaaggactatactggcccaagatagcacacatccctttagtatatattgatgacaagtcacgctcctcgacctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

132

Amino Acids

14.94

Weight (kDa)

8.46

Isoelectric Point (pI)

42.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001766)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g02200 FvH4_7g02200 FvH4_7g02200 FvH4_7g02401 FvH4_7g02420
malus_domestica	MD00G1168500.v1.1 MD03G1026300.v1.1 MD03G1042200.v1.1 MD07G1033400.v1.1 MD07G1033500.v1.1 MD11G1030100.v1.1
prunus_persica	Prupe.2G040600_v2.0.a1
pyrus_communis	pycom11g02400 pycom11g02440 pycom11g02540 pycom11g02570 pycom11g02690 pycom11g02740 pycom11g02780 pycom13g25150
rosa_chinensis	RchiOBHm_Chr1g0320151 RchiOBHm_Chr1g0320231 RchiOBHm_Chr1g0320271 RchiOBHm_Chr1g0320441 RchiOBHm_Chr1g0320651 RchiOBHm_Chr1g0321001 RchiOBHm_Chr4g0408891 RchiOBHm_Chr5g0041681
rosa_laevigata	RLG00000026798
rosa_multiflora	Rmu_co8013808.1_g000001 Rmu_co8327331.1_g000001 Rmu_sc0000576.1_g000015 Rmu_sc0000576.1_g000025 Rmu_sc0001049.1_g000010 Rmu_sc0003145.1_g000003 Rmu_sc0003629.1_g000066 Rmu_sc0004180.1_g000018 Rmu_sc0004180.1_g000019 Rmu_sc0004180.1_g000031 Rmu_sc0021951.1_g000001
rosa_roxburghii	Rroxscaffold_4G00284020 Rroxscaffold_4G00284030 Rroxscaffold_4G00327800
rosa_samantha	Rh1BG007600 Rh1BG008000 Rh1BG042200 Rh5CG317500 Rh7BG428200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	46
AclWI	GGATC	1 cut(s)	56
AcsI	RAATTY	1 cut(s)	100
AdeI	CACNNNGTG	1 cut(s)	95
AfiI	CCNNNNNNNGG	1 cut(s)	260
AgsI	TTSAA	3 cut(s)	143, 194, 314
AjnI	CCWGG	1 cut(s)	91
AjuI	GAANNNNNNNTTGG	2 cut(s)	135, 167
AluBI	AGCT	2 cut(s)	231, 241
AluI	AGCT	2 cut(s)	231, 241
AlwI	GGATC	1 cut(s)	56
AoxI	GGCC	2 cut(s)	262, 338
ApeKI	GCWGC	1 cut(s)	121
ApoI	RAATTY	1 cut(s)	100
AspS9I	GGNCC	2 cut(s)	262, 339
AsuHPI	GGTGA	3 cut(s)	19, 107, 193
AsuII	TTCGAA	1 cut(s)	104
BbvI	GCAGC	1 cut(s)	108
BciT130I	CCWGG	1 cut(s)	93
BfaI	CTAG	1 cut(s)	397
BisI	GCNGC	1 cut(s)	122
BlsI	GCNGC	1 cut(s)	123
Bme1390I	CCNGG	1 cut(s)	93
BmgT120I	GGNCC	2 cut(s)	262, 339
BmrFI	CCNGG	1 cut(s)	93
BmsI	GCATC	3 cut(s)	108, 231, 311
BpmI	CTGGAG	1 cut(s)	211
Bpu14I	TTCGAA	1 cut(s)	104
BpuEI	CTTGAG	2 cut(s)	230, 308
Bsc4I	CCNNNNNNNGG	1 cut(s)	260
Bse1I	ACTGG	1 cut(s)	341
BseBI	CCWGG	1 cut(s)	93
BseGI	GGATG	1 cut(s)	354
BseLI	CCNNNNNNNGG	1 cut(s)	260
BseMII	CTCAG	1 cut(s)	170
BseNI	ACTGG	1 cut(s)	341
BseRI	GAGGAG	2 cut(s)	272, 379
BseXI	GCAGC	1 cut(s)	108
BshFI	GGCC	2 cut(s)	264, 340
BslI	CCNNNNNNNGG	1 cut(s)	260
BsnI	GGCC	2 cut(s)	264, 340
Bsp119I	TTCGAA	1 cut(s)	104
Bsp143I	GATC	3 cut(s)	48, 67, 131
BspACI	CCGC	1 cut(s)	46
BspANI	GGCC	2 cut(s)	264, 340
BspCNI	CTCAG	1 cut(s)	171
BspPI	GGATC	1 cut(s)	56
BspT104I	TTCGAA	1 cut(s)	104
BsrI	ACTGG	1 cut(s)	341
BssMI	GATC	3 cut(s)	48, 67, 131
Bst2UI	CCWGG	1 cut(s)	93
Bst4CI	ACNGT	1 cut(s)	56
Bst6I	CTCTTC	1 cut(s)	309
BstBI	TTCGAA	1 cut(s)	104
BstC8I	GCNNGC	1 cut(s)	266
BstDEI	CTNAG	1 cut(s)	179
BstF5I	GGATG	1 cut(s)	354
BstKTI	GATC	3 cut(s)	51, 70, 134
BstMBI	GATC	3 cut(s)	48, 67, 131
BstMWI	GCNNNNNNNGC	1 cut(s)	228
BstNI	CCWGG	1 cut(s)	93
BstSCI	CCNGG	1 cut(s)	91
BstV1I	GCAGC	1 cut(s)	108
BstX2I	RGATCY	1 cut(s)	48
BstYI	RGATCY	1 cut(s)	48
BsuRI	GGCC	2 cut(s)	264, 340
BtsCI	GGATG	1 cut(s)	354
Cac8I	GCNNGC	1 cut(s)	266
Cfr13I	GGNCC	2 cut(s)	262, 339
CsiI	ACCWGGT	1 cut(s)	91
CviJI	RGCY	5 cut(s)	189, 231, 241, 264, 340
CviKI_1	RGCY	5 cut(s)	189, 231, 241, 264, 340
DdeI	CTNAG	1 cut(s)	179
DpnI	GATC	3 cut(s)	50, 69, 133
DpnII	GATC	3 cut(s)	48, 67, 131
DraIII	CACNNNGTG	1 cut(s)	95
Eam1104I	CTCTTC	1 cut(s)	309
EarI	CTCTTC	1 cut(s)	309
EcoO109I	RGGNCCY	1 cut(s)	262
EcoRI	GAATTC	1 cut(s)	100
EcoRII	CCWGG	1 cut(s)	91
FaiI	YATR	3 cut(s)	334, 367, 369
Fnu4HI	GCNGC	1 cut(s)	122
FokI	GGATG	1 cut(s)	341
Fsp4HI	GCNGC	1 cut(s)	122
FspBI	CTAG	1 cut(s)	397
GluI	GCNGC	1 cut(s)	122
GsuI	CTGGAG	1 cut(s)	211
HaeIII	GGCC	2 cut(s)	264, 340
HinfI	GANTC	3 cut(s)	5, 24, 156
HphI	GGTGA	3 cut(s)	19, 107, 193
Hpy188I	TCNGA	1 cut(s)	237
Hpy188III	TCNNGA	2 cut(s)	209, 254
HpyAV	CCTTC	2 cut(s)	100, 106
HpyCH4III	ACNGT	1 cut(s)	56
HpyCH4V	TGCA	2 cut(s)	19, 324
HpyF10VI	GCNNNNNNNGC	1 cut(s)	228
HpyF3I	CTNAG	1 cut(s)	179
Kzo9I	GATC	3 cut(s)	48, 67, 131
LmnI	GCTCC	2 cut(s)	129, 392
LpnPI	CCDG	7 cut(s)	62, 78, 105, 241, 267, 278, 322
Lsp1109I	GCAGC	1 cut(s)	108
LweI	GCATC	3 cut(s)	108, 231, 311
MabI	ACCWGGT	1 cut(s)	91
MaeI	CTAG	1 cut(s)	397
MaeIII	GTNAC	1 cut(s)	381
MalI	GATC	3 cut(s)	50, 69, 133
MboI	GATC	3 cut(s)	48, 67, 131
MboII	GAAGA	3 cut(s)	151, 209, 326
MfeI	CAATTG	1 cut(s)	150
MflI	RGATCY	1 cut(s)	48
MluCI	AATT	5 cut(s)	41, 100, 143, 150, 194
MlyI	GAGTC	1 cut(s)	18
MnlI	CCTC	8 cut(s)	40, 65, 209, 214, 250, 253, 279, 315
MspA1I	CMGCKG	1 cut(s)	231
MspR9I	CCNGG	1 cut(s)	93
MunI	CAATTG	1 cut(s)	150
MvaI	CCWGG	1 cut(s)	93
MwoI	GCNNNNNNNGC	1 cut(s)	228
NdeII	GATC	3 cut(s)	48, 67, 131
NmuCI	GTSAC	1 cut(s)	381
NspV	TTCGAA	1 cut(s)	104
PfeI	GAWTC	2 cut(s)	5, 156
PkrI	GCNGC	1 cut(s)	123
PleI	GAGTC	1 cut(s)	18
PpsI	GAGTC	1 cut(s)	18
Psp6I	CCWGG	1 cut(s)	91
PspGI	CCWGG	1 cut(s)	91
PspPI	GGNCC	2 cut(s)	262, 339
PsuI	RGATCY	1 cut(s)	48
PvuII	CAGCTG	1 cut(s)	231
SatI	GCNGC	1 cut(s)	122
Sau3AI	GATC	3 cut(s)	48, 67, 131
Sau96I	GGNCC	2 cut(s)	262, 339
SchI	GAGTC	1 cut(s)	18
ScrFI	CCNGG	1 cut(s)	93
SetI	ASST	7 cut(s)	32, 76, 94, 206, 233, 243, 398
SexAI	ACCWGGT	1 cut(s)	91
SfaNI	GCATC	3 cut(s)	108, 231, 311
SfuI	TTCGAA	1 cut(s)	104
SmlI	CTYRAG	3 cut(s)	9, 209, 287
SmoI	CTYRAG	3 cut(s)	9, 209, 287
Sse9I	AATT	5 cut(s)	41, 100, 143, 150, 194
SsiI	CCGC	1 cut(s)	46
SspMI	CTAG	1 cut(s)	397
StyD4I	CCNGG	1 cut(s)	91
TaaI	ACNGT	1 cut(s)	56
TaqI	TCGA	3 cut(s)	70, 104, 392
TasI	AATT	5 cut(s)	41, 100, 143, 150, 194
TfiI	GAWTC	2 cut(s)	5, 156
TseFI	GTSAC	1 cut(s)	381
TseI	GCWGC	1 cut(s)	121
Tsp45I	GTSAC	1 cut(s)	381
XapI	RAATTY	1 cut(s)	100
XspI	CTAG	1 cut(s)	397

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.