MD14G1118500.v1.1

ABC transporter C family member 10-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Reverse (-)
19319268 .. 19319587
320 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1118500.v1.1.491

Sequence Viewer

Length: 237 bp
ATGCTGTTTTATGACTCAACACCCGTGGGAAGGATACTTAGTCGGGTATCTACAGATATGAATATCATTGACCTTGAAGTGGCTTTCAAGTTTATCATTGCGGTTGGGGGAACTTTGAACACATATAGCATATTTTTAGTATTGGTTTTTCGTACTTGGCTAGTCGTGTTTCTGATTATTCCCACAATTTATGTTACTATAGTCTTACAAGTACTTAAGAGAGACACTCTTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.9

Weight (kDa)

8.14

Isoelectric Point (pI)

29.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC_membrane PF00664 1 - 71 1.3e-07 ABC transporter transmembrane region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AfaI GTAC 2 cut(s) 154, 213
AfiI CCNNNNNNNGG 2 cut(s) 30, 79
AflII CTTAAG 1 cut(s) 215
AgsI TTSAA 3 cut(s) 77, 88, 118
Alw26I GTCTC 1 cut(s) 216
BciVI GTATCC 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 216
BfaI CTAG 1 cut(s) 161
BfmI CTRYAG 2 cut(s) 51, 198
BfrI CTTAAG 1 cut(s) 215
BfuI GTATCC 1 cut(s) 27
BmcAI AGTACT 1 cut(s) 213
BplI GAGNNNNNCTC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 2 cut(s) 30, 79
Bse3DI GCAATG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 30, 79
BseMI GCAATG 1 cut(s) 96
BslI CCNNNNNNNGG 2 cut(s) 30, 79
BsmAI GTCTC 1 cut(s) 216
BspACI CCGC 1 cut(s) 101
BspTI CTTAAG 1 cut(s) 215
BsrDI GCAATG 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 24
BstAFI CTTAAG 1 cut(s) 215
BstDEI CTNAG 1 cut(s) 38
BstDSI CCRYGG 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 216
BstSFI CTRYAG 2 cut(s) 51, 198
BsuI GTATCC 1 cut(s) 27
BtgI CCRYGG 1 cut(s) 24
Csp6I GTAC 2 cut(s) 153, 212
CspCI CAANNNNNGTGG 2 cut(s) 6, 41
CviJI RGCY 2 cut(s) 83, 160
CviKI_1 RGCY 2 cut(s) 83, 160
CviQI GTAC 2 cut(s) 153, 212
DdeI CTNAG 1 cut(s) 38
FaiI YATR 7 cut(s) 12, 59, 124, 126, 131, 192, 200
FspBI CTAG 1 cut(s) 161
HinfI GANTC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 174
HpyAV CCTTC 1 cut(s) 24
HpyF3I CTNAG 1 cut(s) 38
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 193
MluCI AATT 1 cut(s) 186
MlyI GAGTC 1 cut(s) 8
MseI TTAA 1 cut(s) 216
MspCI CTTAAG 1 cut(s) 215
PleI GAGTC 1 cut(s) 8
PpsI GAGTC 1 cut(s) 8
RsaI GTAC 2 cut(s) 154, 213
RsaNI GTAC 2 cut(s) 153, 212
SaqAI TTAA 1 cut(s) 216
ScaI AGTACT 1 cut(s) 213
SchI GAGTC 1 cut(s) 8
SetI ASST 1 cut(s) 75
SfcI CTRYAG 2 cut(s) 51, 198
SgeI CNNG 9 cut(s) 35, 37, 56, 86, 100, 168, 173, 178, 221
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 1 cut(s) 186
SsiI CCGC 1 cut(s) 101
SspMI CTAG 1 cut(s) 161
TasI AATT 1 cut(s) 186
TatI WGTACW 1 cut(s) 211
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TspDTI ATGAA 1 cut(s) 74
Vha464I CTTAAG 1 cut(s) 215
XspI CTAG 1 cut(s) 161
ZrmI AGTACT 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.