RchiOBHm_Chr1g0313931

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
1133396 .. 1133724
329 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54466

Sequence Viewer

Length: 213 bp
ATGGTCTTTCTGGCAATTCAGCTACAGAAATATTACTTTTCCACTGCAAAGGAGTTGATGAGGATCAATGGAACAACCAAGTCTTTTGTAGCAAATCATCTAGCAGAGTCTGTATCAGGCGCCATTACAATAAGAGCTTTCAATGAAGAAGAGCGCTTCTTGGCAAAGAATTTTCACCTCATTGACACAAATGCTAGCCCATTTTTTTCATAG

Protein Analysis

70

Amino Acids

7.98

Weight (kDa)

8.14

Isoelectric Point (pI)

25.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 119
AclWI GGATC 1 cut(s) 71
AcsI RAATTY 1 cut(s) 169
AcyI GRCGYC 1 cut(s) 120
AfeI AGCGCT 1 cut(s) 155
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 2 cut(s) 22, 137
AluI AGCT 2 cut(s) 22, 137
AlwI GGATC 1 cut(s) 71
AlwNI CAGNNNCTG 1 cut(s) 110
Aor51HI AGCGCT 1 cut(s) 155
ApoI RAATTY 1 cut(s) 169
AspLEI GCGC 2 cut(s) 122, 156
AsuHPI GGTGA 1 cut(s) 167
AsuNHI GCTAGC 1 cut(s) 194
BanI GGYRCC 1 cut(s) 119
BfaI CTAG 2 cut(s) 101, 195
BfmI CTRYAG 1 cut(s) 23
BfoI RGCGCY 2 cut(s) 123, 157
BmiI GGNNCC 1 cut(s) 121
BmtI GCTAGC 1 cut(s) 198
BsaBI GATNNNNATC 1 cut(s) 62
BsaHI GRCGYC 1 cut(s) 120
Bse8I GATNNNNATC 1 cut(s) 62
BseJI GATNNNNATC 1 cut(s) 62
BshNI GGYRCC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 121
BspOI GCTAGC 1 cut(s) 198
BspPI GGATC 1 cut(s) 71
BspQI GCTCTTC 1 cut(s) 144
BspT107I GGYRCC 1 cut(s) 119
BssMI GATC 1 cut(s) 63
BssNI GRCGYC 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 144
BstACI GRCGYC 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 196
BstH2I RGCGCY 2 cut(s) 123, 157
BstHHI GCGC 2 cut(s) 122, 156
BstKTI GATC 1 cut(s) 66
BstMBI GATC 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 23
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 196
CaiI CAGNNNCTG 1 cut(s) 110
CfoI GCGC 2 cut(s) 122, 156
CviJI RGCY 3 cut(s) 22, 137, 198
CviKI_1 RGCY 3 cut(s) 22, 137, 198
DinI GGCGCC 1 cut(s) 121
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 144
EarI CTCTTC 1 cut(s) 144
Eco47III AGCGCT 1 cut(s) 155
EgeI GGCGCC 1 cut(s) 121
EheI GGCGCC 1 cut(s) 121
FaiI YATR 1 cut(s) 211
FspBI CTAG 2 cut(s) 101, 195
FspEI CC 9 cut(s) 35, 46, 54, 55, 91, 102, 136, 146, 191
GlaI GCGC 2 cut(s) 121, 155
HaeII RGCGCY 2 cut(s) 123, 157
HhaI GCGC 2 cut(s) 122, 156
Hin1I GRCGYC 1 cut(s) 120
Hin6I GCGC 2 cut(s) 120, 154
HinP1I GCGC 2 cut(s) 120, 154
HinfI GANTC 1 cut(s) 107
HphI GGTGA 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 47
Hsp92I GRCGYC 1 cut(s) 120
HspAI GCGC 2 cut(s) 120, 154
KasI GGCGCC 1 cut(s) 119
Kzo9I GATC 1 cut(s) 63
LguI GCTCTTC 1 cut(s) 144
LpnPI CCDG 1 cut(s) 102
MaeI CTAG 2 cut(s) 101, 195
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 2 cut(s) 158, 161
MluCI AATT 2 cut(s) 15, 169
Mly113I GGCGCC 1 cut(s) 120
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 2 cut(s) 54, 188
NarI GGCGCC 1 cut(s) 120
NdeII GATC 1 cut(s) 63
NheI GCTAGC 1 cut(s) 194
NlaIV GGNNCC 1 cut(s) 121
PciSI GCTCTTC 1 cut(s) 144
PleI GAGTC 1 cut(s) 115
PluTI GGCGCC 1 cut(s) 123
PpsI GAGTC 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 110
SapI GCTCTTC 1 cut(s) 144
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 116
SetI ASST 3 cut(s) 24, 139, 180
SfcI CTRYAG 1 cut(s) 23
SfoI GGCGCC 1 cut(s) 121
SgeI CNNG 6 cut(s) 23, 91, 113, 129, 172, 207
Sse9I AATT 2 cut(s) 15, 169
SspDI GGCGCC 1 cut(s) 119
SspI AATATT 1 cut(s) 32
SspMI CTAG 2 cut(s) 101, 195
TasI AATT 2 cut(s) 15, 169
TscAI CASTG 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 159, 198
TspRI CASTG 1 cut(s) 49
XapI RAATTY 1 cut(s) 169
XspI CTAG 2 cut(s) 101, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.