Rh2BG250900

26S proteasome non-ATPase regulatory subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0001692
Physical Location & Seq
Forward (+)
25711977 .. 25714922
2946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG250900.1

Sequence Viewer

Length: 315 bp
ATGGTGAAGAGGCGGAAGCTGAGTGTTTCTCTGCTCTCAGCGTTTCTCAGTTTCTCCTTTTCGTCGGGATCTGATGCTCACACCAAGCTACACAATTATATTGCAAAGAGGATAGGTTGTCCTCCTATCTTTCGAAGGCTAAAGCTTAAATTAGAGGGGAGTAGCTTAAGTCAGTCATCTTCCGTCCAGGAGAAATTTGATAAATTGCGGAGATGTCTCAAACGCTCCTTAAAGAAGGTTAGGTCCCCATTTTTTAAATTTGAGGTTCCAAATCGGGTTCAGGCCATGTACTTGACCTGGGTTCGGAGCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03050 ko05169 map03050 map05169
Pfam Domains
Protein Families
PCI Rpn3_C

Protein Analysis

104

Amino Acids

12.08

Weight (kDa)

11.27

Isoelectric Point (pI)

70.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 208
AclWI GGATC 1 cut(s) 76
AcsI RAATTY 2 cut(s) 194, 257
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 303
AflII CTTAAG 1 cut(s) 166
AjnI CCWGG 2 cut(s) 186, 296
AluBI AGCT 4 cut(s) 19, 88, 145, 165
AluI AGCT 4 cut(s) 19, 88, 145, 165
Alw26I GTCTC 1 cut(s) 221
AlwI GGATC 1 cut(s) 76
AoxI GGCC 1 cut(s) 282
ApoI RAATTY 2 cut(s) 194, 257
AspS9I GGNCC 1 cut(s) 243
AsuHPI GGTGA 1 cut(s) 16
AsuII TTCGAA 1 cut(s) 133
AvaII GGWCC 1 cut(s) 243
BciT130I CCWGG 2 cut(s) 188, 298
BcoDI GTCTC 1 cut(s) 221
BfaI CTAG 1 cut(s) 313
BfrI CTTAAG 1 cut(s) 166
Bme1390I CCNGG 2 cut(s) 188, 298
Bme18I GGWCC 1 cut(s) 243
BmgT120I GGNCC 1 cut(s) 243
BmiI GGNNCC 3 cut(s) 245, 267, 308
BmrFI CCNGG 2 cut(s) 188, 298
BmsI GCATC 1 cut(s) 64
BplI GAGNNNNNCTC 2 cut(s) 13, 45
Bpu14I TTCGAA 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 297
Bsc4I CCNNNNNNNGG 1 cut(s) 303
BseBI CCWGG 2 cut(s) 188, 298
BseDI CCNNGG 1 cut(s) 297
BseLI CCNNNNNNNGG 1 cut(s) 303
BseMII CTCAG 3 cut(s) 11, 51, 61
BshFI GGCC 1 cut(s) 284
BslFI GGGAC 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 303
BsmAI GTCTC 1 cut(s) 221
BsmFI GGGAC 1 cut(s) 229
BsnI GGCC 1 cut(s) 284
Bsp119I TTCGAA 1 cut(s) 133
Bsp143I GATC 1 cut(s) 68
BspACI CCGC 2 cut(s) 13, 208
BspANI GGCC 1 cut(s) 284
BspCNI CTCAG 3 cut(s) 12, 50, 60
BspLI GGNNCC 3 cut(s) 245, 267, 308
BspPI GGATC 1 cut(s) 76
BspT104I TTCGAA 1 cut(s) 133
BspTI CTTAAG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 297
BssMI GATC 1 cut(s) 68
Bst2UI CCWGG 2 cut(s) 188, 298
Bst6I CTCTTC 1 cut(s) 2
BstAFI CTTAAG 1 cut(s) 166
BstBI TTCGAA 1 cut(s) 133
BstDEI CTNAG 3 cut(s) 20, 37, 47
BstKTI GATC 1 cut(s) 71
BstMAI GTCTC 1 cut(s) 221
BstMBI GATC 1 cut(s) 68
BstNI CCWGG 2 cut(s) 188, 298
BstSCI CCNGG 2 cut(s) 186, 296
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BsuRI GGCC 1 cut(s) 284
Cfr13I GGNCC 1 cut(s) 243
Csp6I GTAC 1 cut(s) 289
CviAII CATG 1 cut(s) 286
CviJI RGCY 7 cut(s) 19, 88, 139, 145, 165, 284, 309
CviKI_1 RGCY 7 cut(s) 19, 88, 139, 145, 165, 284, 309
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 3 cut(s) 20, 37, 47
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
DraI TTTAAA 1 cut(s) 256
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
EciI GGCGGA 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 243
EcoO109I RGGNCCY 1 cut(s) 243
EcoRII CCWGG 2 cut(s) 186, 296
FaeI CATG 1 cut(s) 289
FaiI YATR 2 cut(s) 99, 287
FaqI GGGAC 1 cut(s) 229
FatI CATG 1 cut(s) 285
FspBI CTAG 1 cut(s) 313
HaeIII GGCC 1 cut(s) 284
Hin1II CATG 1 cut(s) 289
HindIII AAGCTT 1 cut(s) 143
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 73, 306
Hpy188III TCNNGA 1 cut(s) 66
Hpy99I CGWCG 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 129, 229
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 3 cut(s) 20, 37, 47
Hsp92II CATG 1 cut(s) 289
Kzo9I GATC 1 cut(s) 68
LmnI GCTCC 2 cut(s) 230, 306
LpnPI CCDG 5 cut(s) 173, 200, 266, 283, 310
LweI GCATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 313
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MboII GAAGA 2 cut(s) 19, 171
MflI RGATCY 1 cut(s) 68
MluCI AATT 5 cut(s) 94, 149, 194, 203, 257
MnlI CCTC 5 cut(s) 3, 102, 132, 148, 256
MseI TTAA 4 cut(s) 147, 167, 230, 255
MspCI CTTAAG 1 cut(s) 166
MspR9I CCNGG 2 cut(s) 188, 298
MvaI CCWGG 2 cut(s) 188, 298
NdeII GATC 1 cut(s) 68
NlaIII CATG 1 cut(s) 289
NlaIV GGNNCC 3 cut(s) 245, 267, 308
NspV TTCGAA 1 cut(s) 133
PfoI TCCNGGA 1 cut(s) 186
PpuMI RGGWCCY 1 cut(s) 243
Psp5II RGGWCCY 1 cut(s) 243
Psp6I CCWGG 2 cut(s) 186, 296
PspGI CCWGG 2 cut(s) 186, 296
PspN4I GGNNCC 3 cut(s) 245, 267, 308
PspPI GGNCC 1 cut(s) 243
PspPPI RGGWCCY 1 cut(s) 243
PsuI RGATCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 4 cut(s) 147, 167, 230, 255
Sau3AI GATC 1 cut(s) 68
Sau96I GGNCC 1 cut(s) 243
ScrFI CCNGG 2 cut(s) 188, 298
SetI ASST 9 cut(s) 21, 90, 118, 147, 167, 240, 245, 267, 299
SfaNI GCATC 1 cut(s) 64
SfuI TTCGAA 1 cut(s) 133
SinI GGWCC 1 cut(s) 243
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 5 cut(s) 94, 149, 194, 203, 257
SsiI CCGC 2 cut(s) 13, 208
SspMI CTAG 1 cut(s) 313
StyD4I CCNGG 2 cut(s) 186, 296
TaqI TCGA 1 cut(s) 133
TasI AATT 5 cut(s) 94, 149, 194, 203, 257
TatI WGTACW 1 cut(s) 288
Tru1I TTAA 4 cut(s) 147, 167, 230, 255
Tru9I TTAA 4 cut(s) 147, 167, 230, 255
TspGWI ACGGA 1 cut(s) 172
Vha464I CTTAAG 1 cut(s) 166
VpaK11BI GGWCC 1 cut(s) 243
XapI RAATTY 2 cut(s) 194, 257
XspI CTAG 1 cut(s) 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.