MD17G1171400.v1.1

Aminopeptidase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
17646553 .. 17647963
1411 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1171400.v1.1.491

Sequence Viewer

Length: 408 bp
ATGTTCATCCAAGTTTTGTTCACCAGCTCTCGAGGCCAAAATGTGGCAATTACTCAATTCGAACCTGTAGATGCATGGTGGAGCTTTCCATGTTGCGATGAACCTGCTCTGAAGGACACTTTCAAGATAGCAGTAGATGTTCCACTGGAGCTGACAGCTTTATCCAATATGCCAATTGTCAATGAGAAGCTTGATGCAAATATACTTCCAACGTCATACTTTCTCCCCAAACTCGATGTGGTTGTGGTTCCTCAATTTTCTGGTGGGGCAATGGAGAATTATGGTTTGATCACATATTGTGAAAATGAACTGCTTTATGATCCTTTGCATTCCACGATGGCAAGGAAGCAAAGAATAAGTTTAATTTCTAATTCCACTTTAAGCTTTGTTGCACTTTTGCTGTTGTAA

Protein Analysis

136

Amino Acids

15.1

Weight (kDa)

4.53

Isoelectric Point (pI)

30.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M1_N PF17900 11 - 67 2.3e-15 Peptidase M1 N-terminal domain
Peptidase_M1 PF01433 66 - 120 3.2e-13 Peptidase family M1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000648)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 112
AccB7I CCANNNNNTGG 1 cut(s) 43
AclWI GGATC 1 cut(s) 314
AcuI CTGAAG 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 6 cut(s) 27, 84, 151, 158, 190, 384
AluI AGCT 6 cut(s) 27, 84, 151, 158, 190, 384
AlwI GGATC 1 cut(s) 314
Ama87I CYCGRG 1 cut(s) 30
AoxI GGCC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 13
AsuII TTCGAA 1 cut(s) 60
AvaI CYCGRG 1 cut(s) 30
BccI CCATC 1 cut(s) 331
BcgI CGANNNNNNTGC 2 cut(s) 86, 120
BclI TGATCA 1 cut(s) 288
BfmI CTRYAG 1 cut(s) 66
BfuAI ACCTGC 1 cut(s) 112
BmeT110I CYCGRG 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 249
BmsI GCATC 2 cut(s) 61, 184
BpmI CTGGAG 1 cut(s) 167
Bpu14I TTCGAA 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 150
Bse3DI GCAATG 1 cut(s) 276
BseGI GGATG 1 cut(s) 6
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMI GCAATG 1 cut(s) 276
BseNI ACTGG 1 cut(s) 150
BshFI GGCC 1 cut(s) 36
BsiHKCI CYCGRG 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 43
BsmI GAATGC 1 cut(s) 328
BsnI GGCC 1 cut(s) 36
BsoBI CYCGRG 1 cut(s) 30
Bsp119I TTCGAA 1 cut(s) 60
Bsp143I GATC 2 cut(s) 288, 319
BspANI GGCC 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 249
BspMI ACCTGC 1 cut(s) 112
BspPI GGATC 1 cut(s) 314
BspT104I TTCGAA 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 276
BsrI ACTGG 1 cut(s) 150
BssMI GATC 2 cut(s) 288, 319
BstBI TTCGAA 1 cut(s) 60
BstF5I GGATG 1 cut(s) 6
BstKTI GATC 2 cut(s) 291, 322
BstMBI GATC 2 cut(s) 288, 319
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstSFI CTRYAG 1 cut(s) 66
BsuRI GGCC 1 cut(s) 36
BtgZI GCGATG 1 cut(s) 111
BtsCI GGATG 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 143
BveI ACCTGC 1 cut(s) 112
CviAII CATG 2 cut(s) 75, 90
CviJI RGCY 7 cut(s) 27, 36, 84, 151, 158, 190, 384
CviKI_1 RGCY 7 cut(s) 27, 36, 84, 151, 158, 190, 384
DpnI GATC 2 cut(s) 290, 321
DpnII GATC 2 cut(s) 288, 319
Eco57I CTGAAG 1 cut(s) 131
Eco88I CYCGRG 1 cut(s) 30
EcoT22I ATGCAT 1 cut(s) 76
FaeI CATG 2 cut(s) 78, 93
FaiI YATR 8 cut(s) 76, 91, 170, 203, 217, 282, 295, 318
FatI CATG 2 cut(s) 74, 89
FbaI TGATCA 1 cut(s) 288
GsuI CTGGAG 1 cut(s) 167
HaeIII GGCC 1 cut(s) 36
Hin1II CATG 2 cut(s) 78, 93
HindIII AAGCTT 2 cut(s) 188, 382
HphI GGTGA 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 2 cut(s) 30, 124
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 212
HpyCH4V TGCA 4 cut(s) 74, 197, 328, 392
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 212
Hsp92II CATG 2 cut(s) 78, 93
Ksp22I TGATCA 1 cut(s) 288
Kzo9I GATC 2 cut(s) 288, 319
LmnI GCTCC 2 cut(s) 81, 148
LpnPI CCDG 5 cut(s) 37, 78, 117, 131, 246
LweI GCATC 2 cut(s) 61, 184
MaeII ACGT 1 cut(s) 212
MalI GATC 2 cut(s) 290, 321
MboI GATC 2 cut(s) 288, 319
MfeI CAATTG 1 cut(s) 174
MluCI AATT 7 cut(s) 48, 56, 174, 254, 277, 363, 370
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 2 cut(s) 26, 261
Mph1103I ATGCAT 1 cut(s) 76
MseI TTAA 2 cut(s) 362, 380
MunI CAATTG 1 cut(s) 174
Mva1269I GAATGC 1 cut(s) 328
MwoI GCNNNNNNNGC 1 cut(s) 33
NdeII GATC 2 cut(s) 288, 319
NlaIII CATG 2 cut(s) 78, 93
NlaIV GGNNCC 1 cut(s) 249
NsiI ATGCAT 1 cut(s) 76
NspV TTCGAA 1 cut(s) 60
PaeR7I CTCGAG 1 cut(s) 30
PctI GAATGC 1 cut(s) 328
PflMI CCANNNNNTGG 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 249
SaqAI TTAA 2 cut(s) 362, 380
Sau3AI GATC 2 cut(s) 288, 319
SetI ASST 9 cut(s) 29, 67, 86, 106, 153, 160, 192, 215, 386
SfaNI GCATC 2 cut(s) 61, 184
SfcI CTRYAG 1 cut(s) 66
Sfr274I CTCGAG 1 cut(s) 30
SfuI TTCGAA 1 cut(s) 60
SlaI CTCGAG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 30
SmoI CTYRAG 1 cut(s) 30
Sse9I AATT 7 cut(s) 48, 56, 174, 254, 277, 363, 370
TaiI ACGT 1 cut(s) 215
TaqI TCGA 3 cut(s) 31, 60, 234
TasI AATT 7 cut(s) 48, 56, 174, 254, 277, 363, 370
Tru1I TTAA 2 cut(s) 362, 380
Tru9I TTAA 2 cut(s) 362, 380
TscAI CASTG 1 cut(s) 150
TspDTI ATGAA 2 cut(s) 114, 321
TspRI CASTG 1 cut(s) 150
Van91I CCANNNNNTGG 1 cut(s) 43
XcmI CCANNNNNNNNNTGG 1 cut(s) 235
XhoI CTCGAG 1 cut(s) 30
Zsp2I ATGCAT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.