Prupe.2G246500_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0001015
Physical Location & Seq
Forward (+)
26320717 .. 26321950
1234 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G246500.1

Sequence Viewer

Length: 549 bp
ATGGGGAGGATGGCATCGGCACATGACCATTCTAACATGAAGAATGGTGGACATCGGAGCAAAGCCCTGATGAGGAACACGAGAATACCTGCAGGAAAAAGCTTATTGCTTCAACGTGACTTAGACCATCAAGTTGTTTTGAGTGTGACCATATACCATGCGGACGGCGTTGACGACCCAAGTAGCAGTACCATCTGTGCTTCCGATCGGATTTACAGAGCTCTTGTGTGGGTTGAACCCGGCACAGAGTATCGGACTCCTTTTGTTCGTGCCTTACCAGACCCTAGATGGGACGGAAAATGCGAAATTCCGTTGAGGACCAGCCTTTTGGATTGGGGGCACCTGAACGTAGAGGTCATGAGGGGGAGTAACGACACCGAGCCAGGAACCTCTAATGGCATAGCCAGCGTGAGCAGGGCTAGAATCCCTCTGCCAAAGAAGATGGATCAGAAAAAGGAAGGCCGGTTTGGACTCGTGAGGAATGAAGGGCCTGGGCTGGTCAAGGCTGAAGGCCACATAATTTTGTCTATGAAAGTGAAGGAACGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2

Protein Analysis

183

Amino Acids

20.23

Weight (kDa)

9.65

Isoelectric Point (pI)

26.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 97
AccB1I GGYRCC 1 cut(s) 339
AciI CCGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 453
AcsI RAATTY 1 cut(s) 306
AcuI CTGAAG 1 cut(s) 528
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 2 cut(s) 72, 289
AgsI TTSAA 2 cut(s) 113, 236
AjnI CCWGG 2 cut(s) 382, 490
AjuI GAANNNNNNNTTGG 2 cut(s) 450, 482
AluBI AGCT 2 cut(s) 102, 221
AluI AGCT 2 cut(s) 102, 221
Alw21I GWGCWC 1 cut(s) 223
AlwI GGATC 1 cut(s) 453
AoxI GGCC 3 cut(s) 460, 488, 511
ApoI RAATTY 1 cut(s) 306
ArsI GACNNNNNNTTYG 2 cut(s) 310, 342
AspS9I GGNCC 2 cut(s) 318, 488
AsuC2I CCSGG 1 cut(s) 240
AvaII GGWCC 1 cut(s) 318
BaeGI GKGCMC 1 cut(s) 342
BanI GGYRCC 1 cut(s) 339
BanII GRGCYC 1 cut(s) 223
BauI CACGAG 2 cut(s) 79, 473
Bbv12I GWGCWC 1 cut(s) 223
BccI CCATC 5 cut(s) 4, 135, 200, 282, 436
BceAI ACGGC 1 cut(s) 181
BciT130I CCWGG 2 cut(s) 384, 492
BcnI CCSGG 1 cut(s) 240
BfaI CTAG 2 cut(s) 285, 420
BfmI CTRYAG 1 cut(s) 90
BfuAI ACCTGC 1 cut(s) 97
Bme1390I CCNGG 3 cut(s) 240, 384, 492
Bme18I GGWCC 1 cut(s) 318
BmgT120I GGNCC 2 cut(s) 318, 488
BmiI GGNNCC 2 cut(s) 341, 388
BmrFI CCNGG 3 cut(s) 240, 384, 492
BmsI GCATC 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 491
Bsc4I CCNNNNNNNGG 2 cut(s) 72, 289
Bse118I RCCGGY 1 cut(s) 462
BseBI CCWGG 2 cut(s) 384, 492
BseDI CCNNGG 1 cut(s) 491
BseGI GGATG 1 cut(s) 15
BseLI CCNNNNNNNGG 2 cut(s) 72, 289
BseSI GKGCMC 1 cut(s) 342
Bsh1285I CGRYCG 1 cut(s) 208
BshFI GGCC 3 cut(s) 462, 490, 513
BshNI GGYRCC 1 cut(s) 339
BsiEI CGRYCG 1 cut(s) 208
BsiHKAI GWGCWC 1 cut(s) 223
BsiSI CCGG 2 cut(s) 240, 463
BslFI GGGAC 1 cut(s) 305
BslI CCNNNNNNNGG 2 cut(s) 72, 289
BsmFI GGGAC 1 cut(s) 305
BsnI GGCC 3 cut(s) 462, 490, 513
Bsp1286I GDGCHC 2 cut(s) 223, 342
Bsp143I GATC 2 cut(s) 205, 445
BspACI CCGC 1 cut(s) 161
BspANI GGCC 3 cut(s) 462, 490, 513
BspHI TCATGA 1 cut(s) 357
BspLI GGNNCC 2 cut(s) 341, 388
BspMAI CTGCAG 1 cut(s) 94
BspMI ACCTGC 1 cut(s) 97
BspPI GGATC 1 cut(s) 453
BspT107I GGYRCC 1 cut(s) 339
BsrFI RCCGGY 1 cut(s) 462
BssAI RCCGGY 1 cut(s) 462
BssECI CCNNGG 1 cut(s) 491
BssMI GATC 2 cut(s) 205, 445
BssSI CACGAG 2 cut(s) 79, 473
Bst2BI CACGAG 2 cut(s) 79, 473
Bst2UI CCWGG 2 cut(s) 384, 492
BstC8I GCNNGC 1 cut(s) 406
BstDEI CTNAG 1 cut(s) 121
BstF5I GGATG 1 cut(s) 15
BstKTI GATC 2 cut(s) 208, 448
BstMBI GATC 2 cut(s) 205, 445
BstMCI CGRYCG 1 cut(s) 208
BstMWI GCNNNNNNNGC 1 cut(s) 405
BstNI CCWGG 2 cut(s) 384, 492
BstSCI CCNGG 3 cut(s) 238, 382, 490
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 342
BstXI CCANNNNNNTGG 1 cut(s) 328
BsuRI GGCC 3 cut(s) 462, 490, 513
BtsCI GGATG 1 cut(s) 15
BveI ACCTGC 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 406
CciI TCATGA 1 cut(s) 357
Cfr10I RCCGGY 1 cut(s) 462
Cfr13I GGNCC 2 cut(s) 318, 488
Csp6I GTAC 1 cut(s) 189
CviAII CATG 4 cut(s) 23, 37, 158, 358
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 1 cut(s) 121
DpnI GATC 2 cut(s) 207, 447
DpnII GATC 2 cut(s) 205, 445
Ecl136II GAGCTC 1 cut(s) 221
Eco24I GRGCYC 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 318
Eco53kI GAGCTC 1 cut(s) 221
Eco57I CTGAAG 1 cut(s) 528
EcoICRI GAGCTC 1 cut(s) 221
EcoO109I RGGNCCY 1 cut(s) 488
EcoRII CCWGG 2 cut(s) 382, 490
EcoT38I GRGCYC 1 cut(s) 223
FaeI CATG 4 cut(s) 26, 40, 161, 361
FaiI YATR 9 cut(s) 24, 38, 152, 154, 159, 359, 401, 518, 530
FaqI GGGAC 1 cut(s) 305
FatI CATG 4 cut(s) 22, 36, 157, 357
FokI GGATG 1 cut(s) 22
FriOI GRGCYC 1 cut(s) 223
FspBI CTAG 2 cut(s) 285, 420
HaeIII GGCC 3 cut(s) 462, 490, 513
HapII CCGG 2 cut(s) 240, 463
Hin1II CATG 4 cut(s) 26, 40, 161, 361
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HindIII AAGCTT 1 cut(s) 100
HinfI GANTC 3 cut(s) 256, 423, 471
HpaII CCGG 2 cut(s) 240, 463
Hpy166II GTNNAC 2 cut(s) 50, 172
Hpy188I TCNGA 5 cut(s) 57, 205, 210, 255, 450
Hpy188III TCNNGA 2 cut(s) 358, 475
Hpy8I GTNNAC 2 cut(s) 50, 172
HpyAV CCTTC 4 cut(s) 452, 479, 503, 532
HpyCH4IV ACGT 2 cut(s) 115, 348
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 405
HpyF3I CTNAG 1 cut(s) 121
HpySE526I ACGT 2 cut(s) 115, 348
Hsp92II CATG 4 cut(s) 26, 40, 161, 361
Kzo9I GATC 2 cut(s) 205, 445
LmnI GCTCC 1 cut(s) 57
LweI GCATC 1 cut(s) 23
MaeI CTAG 2 cut(s) 285, 420
MaeII ACGT 2 cut(s) 115, 348
MaeIII GTNAC 3 cut(s) 116, 145, 368
MalI GATC 2 cut(s) 207, 447
MboI GATC 2 cut(s) 205, 445
MboII GAAGA 2 cut(s) 52, 451
MhlI GDGCHC 2 cut(s) 223, 342
MluCI AATT 2 cut(s) 306, 519
MlyI GAGTC 2 cut(s) 250, 465
MnlI CCTC 7 cut(s) 66, 309, 346, 354, 400, 438, 471
MspI CCGG 2 cut(s) 240, 463
MspR9I CCNGG 3 cut(s) 240, 384, 492
MvaI CCWGG 2 cut(s) 384, 492
MwoI GCNNNNNNNGC 1 cut(s) 405
NciI CCSGG 1 cut(s) 240
NdeII GATC 2 cut(s) 205, 445
NlaIII CATG 4 cut(s) 26, 40, 161, 361
NlaIV GGNNCC 2 cut(s) 341, 388
NmuCI GTSAC 2 cut(s) 116, 145
PagI TCATGA 1 cut(s) 357
PcsI WCGNNNNNNNCGW 2 cut(s) 171, 300
PfeI GAWTC 1 cut(s) 423
Ple19I CGATCG 1 cut(s) 208
PleI GAGTC 2 cut(s) 250, 465
PpsI GAGTC 2 cut(s) 250, 465
Psp124BI GAGCTC 1 cut(s) 223
Psp6I CCWGG 2 cut(s) 382, 490
PspGI CCWGG 2 cut(s) 382, 490
PspN4I GGNNCC 2 cut(s) 341, 388
PspPI GGNCC 2 cut(s) 318, 488
PstI CTGCAG 1 cut(s) 94
PvuI CGATCG 1 cut(s) 208
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SacI GAGCTC 1 cut(s) 223
Sau3AI GATC 2 cut(s) 205, 445
Sau96I GGNCC 2 cut(s) 318, 488
SbfI CCTGCAGG 1 cut(s) 94
SchI GAGTC 2 cut(s) 250, 465
ScrFI CCNGG 3 cut(s) 240, 384, 492
SdaI CCTGCAGG 1 cut(s) 94
SduI GDGCHC 2 cut(s) 223, 342
SetI ASST 8 cut(s) 91, 104, 118, 223, 345, 351, 357, 392
SfaNI GCATC 1 cut(s) 23
SfcI CTRYAG 1 cut(s) 90
SinI GGWCC 1 cut(s) 318
Sse8387I CCTGCAGG 1 cut(s) 94
Sse9I AATT 2 cut(s) 306, 519
SsiI CCGC 1 cut(s) 161
SspMI CTAG 2 cut(s) 285, 420
SstI GAGCTC 1 cut(s) 223
StyD4I CCNGG 3 cut(s) 238, 382, 490
TaiI ACGT 2 cut(s) 118, 351
TasI AATT 2 cut(s) 306, 519
TfiI GAWTC 1 cut(s) 423
TseFI GTSAC 2 cut(s) 116, 145
Tsp45I GTSAC 2 cut(s) 116, 145
TspDTI ATGAA 3 cut(s) 53, 498, 545
TspGWI ACGGA 2 cut(s) 300, 309
VpaK11BI GGWCC 1 cut(s) 318
XapI RAATTY 1 cut(s) 306
XcmI CCANNNNNNNNNTGG 1 cut(s) 285
XspI CTAG 2 cut(s) 285, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.