Prupe.7G253900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
21382579 .. 21382917
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G253900.1

Sequence Viewer

Length: 339 bp
ATGACTAGCGCAGGAGTTGCTGGGATGATGCTTCAGTGTGCATTTGAAGGAAGCCTGTCAATGCAGGACACCGAAATTGAGCGAAGGCCATACCATAAGAACTGCACTTGTGCTCTGCACAAGTTTAAGGGGGGTGCTTGCTCCATCGCTTGTCAAAGGAACGTTTCCTTCCCAAAGAAACATTCACTGAGTGATGGTTCCTTGTGCATGCAGGCATCATCAACTTCCAAATTCTCCTCTCCTCTCGTCGGCGACATGTCCATGTCCACTTCCACATCCACAGGAAACAGAGAAAGTATGAATTGGGTTCATTATTCGGCCTTGTCACATAGACGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.19

Weight (kDa)

9.06

Isoelectric Point (pI)

66.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 162
AcsI RAATTY 1 cut(s) 230
AcuI CTGAAG 1 cut(s) 17
AdeI CACNNNGTG 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 248
AflIII ACRYGT 1 cut(s) 255
AgsI TTSAA 1 cut(s) 47
AjuI GAANNNNNNNTTGG 2 cut(s) 166, 198
Alw21I GWGCWC 1 cut(s) 115
AoxI GGCC 2 cut(s) 86, 318
ApoI RAATTY 1 cut(s) 230
AspLEI GCGC 1 cut(s) 11
Bbv12I GWGCWC 1 cut(s) 115
BccI CCATC 2 cut(s) 152, 188
BfaI CTAG 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 199
BmsI GCATC 2 cut(s) 18, 224
Bsc4I CCNNNNNNNGG 1 cut(s) 248
BseGI GGATG 2 cut(s) 30, 275
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMII CTCAG 1 cut(s) 179
BseRI GAGGAG 2 cut(s) 226, 231
BseYI CCCAGC 1 cut(s) 20
BsgI GTGCAG 2 cut(s) 88, 101
BshFI GGCC 2 cut(s) 88, 320
BsiHKAI GWGCWC 1 cut(s) 115
BslI CCNNNNNNNGG 1 cut(s) 248
BsnI GGCC 2 cut(s) 88, 320
Bsp1286I GDGCHC 1 cut(s) 115
BspANI GGCC 2 cut(s) 88, 320
BspCNI CTCAG 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 336
BstAPI GCANNNNNTGC 1 cut(s) 17
BstC8I GCNNGC 3 cut(s) 139, 209, 213
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 2 cut(s) 30, 275
BstHHI GCGC 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstNSI RCATGY 2 cut(s) 211, 259
BsuRI GGCC 2 cut(s) 88, 320
BtgZI GCGATG 1 cut(s) 130
BtsCI GGATG 2 cut(s) 30, 275
BtsIMutI CAGTG 2 cut(s) 41, 185
Cac8I GCNNGC 3 cut(s) 139, 209, 213
CfoI GCGC 1 cut(s) 11
CviAII CATG 3 cut(s) 208, 256, 262
CviJI RGCY 3 cut(s) 54, 88, 320
CviKI_1 RGCY 3 cut(s) 54, 88, 320
DdeI CTNAG 1 cut(s) 188
DraIII CACNNNGTG 1 cut(s) 191
Eco57I CTGAAG 1 cut(s) 17
FaeI CATG 3 cut(s) 211, 259, 265
FaiI YATR 7 cut(s) 91, 96, 209, 257, 263, 299, 330
FatI CATG 3 cut(s) 207, 255, 261
FokI GGATG 2 cut(s) 37, 262
FspBI CTAG 1 cut(s) 6
GlaI GCGC 1 cut(s) 10
GsaI CCCAGC 1 cut(s) 24
HaeIII GGCC 2 cut(s) 88, 320
HhaI GCGC 1 cut(s) 11
Hin1II CATG 3 cut(s) 211, 259, 265
Hin6I GCGC 1 cut(s) 9
HinP1I GCGC 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 267
Hpy8I GTNNAC 1 cut(s) 267
Hpy99I CGWCG 1 cut(s) 251
HpyAV CCTTC 3 cut(s) 41, 78, 178
HpyCH4III ACNGT 1 cut(s) 336
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 6 cut(s) 41, 64, 105, 118, 207, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 188
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 3 cut(s) 211, 259, 265
HspAI GCGC 1 cut(s) 9
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 5 cut(s) 6, 50, 68, 197, 267
LweI GCATC 2 cut(s) 18, 224
MaeI CTAG 1 cut(s) 6
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 324
MhlI GDGCHC 1 cut(s) 115
MluCI AATT 3 cut(s) 75, 230, 301
MnlI CCTC 2 cut(s) 247, 252
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 260
MwoI GCNNNNNNNGC 1 cut(s) 17
NlaIII CATG 3 cut(s) 211, 259, 265
NlaIV GGNNCC 1 cut(s) 199
NmuCI GTSAC 1 cut(s) 324
NspI RCATGY 2 cut(s) 211, 259
PaeI GCATGC 1 cut(s) 211
PciI ACATGT 1 cut(s) 255
PscI ACATGT 1 cut(s) 255
Psp1406I AACGTT 1 cut(s) 162
PspFI CCCAGC 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 199
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 1 cut(s) 126
SduI GDGCHC 1 cut(s) 115
SetI ASST 1 cut(s) 165
SfaNI GCATC 2 cut(s) 18, 224
SmiMI CAYNNNNRTG 1 cut(s) 260
SphI GCATGC 1 cut(s) 211
Sse9I AATT 3 cut(s) 75, 230, 301
SspMI CTAG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 336
TaiI ACGT 1 cut(s) 165
TasI AATT 3 cut(s) 75, 230, 301
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 2 cut(s) 41, 192
TseFI GTSAC 1 cut(s) 324
Tsp45I GTSAC 1 cut(s) 324
TspDTI ATGAA 2 cut(s) 299, 314
TspRI CASTG 2 cut(s) 41, 192
XapI RAATTY 1 cut(s) 230
XceI RCATGY 2 cut(s) 211, 259
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.