Rw2G001620

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
1338494 .. 1338811
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G001620.1

Sequence Viewer

Length: 318 bp
ATGAATACCTTTGGAGCTTCTGGCATGATGTTTCAGCGTGTGTTTGAAGGAAGCCTATCAATGCAGGACACAGAAATTGAGCGAAGGCCATACCATAAAAACTGCAATTGTGCACTGCACAAGTCAAAGAGGGGTGCTTGTAGCGATGCCTGTCGTCAACAAAGGAACATTTCCTTCCCCAAGAAACAATCATGGACTGATGGATCATTGTGCATGTCAGCAACAACTTCCAAATCGTCCACCCCTCCTGGCACCACATCTATGTCCATCGGAAATATAGAAAGTCTTAATGGTGTCCAATCCTTGTCTCACAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.55

Weight (kDa)

9.4

Isoelectric Point (pI)

81.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 251
AclWI GGATC 1 cut(s) 211
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
Alw21I GWGCWC 1 cut(s) 115
Alw26I GTCTC 1 cut(s) 312
Alw44I GTGCAC 1 cut(s) 111
AlwI GGATC 1 cut(s) 211
AoxI GGCC 1 cut(s) 86
ApaLI GTGCAC 1 cut(s) 111
BaeGI GKGCMC 1 cut(s) 115
BanI GGYRCC 1 cut(s) 251
Bbv12I GWGCWC 1 cut(s) 115
BccI CCATC 2 cut(s) 194, 275
BciT130I CCWGG 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 312
Bme1390I CCNGG 1 cut(s) 249
BmiI GGNNCC 1 cut(s) 253
BmrFI CCNGG 1 cut(s) 249
BmsI GCATC 1 cut(s) 136
BseBI CCWGG 1 cut(s) 249
BseSI GKGCMC 1 cut(s) 115
BsgI GTGCAG 1 cut(s) 101
BshFI GGCC 1 cut(s) 88
BshNI GGYRCC 1 cut(s) 251
BsiHKAI GWGCWC 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 312
BsnI GGCC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 203
BspANI GGCC 1 cut(s) 88
BspLI GGNNCC 1 cut(s) 253
BspPI GGATC 1 cut(s) 211
BspT107I GGYRCC 1 cut(s) 251
BssMI GATC 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 249
BstKTI GATC 1 cut(s) 206
BstMAI GTCTC 1 cut(s) 312
BstMBI GATC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 247
BstSLI GKGCMC 1 cut(s) 115
BsuRI GGCC 1 cut(s) 88
BtgZI GCGATG 1 cut(s) 159
BtsI GCAGTG 1 cut(s) 113
BtsIMutI CAGTG 1 cut(s) 113
CviAII CATG 3 cut(s) 25, 192, 214
CviJI RGCY 3 cut(s) 17, 54, 88
CviKI_1 RGCY 3 cut(s) 17, 54, 88
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
EcoRII CCWGG 1 cut(s) 247
FaeI CATG 3 cut(s) 28, 195, 217
FaiI YATR 7 cut(s) 26, 91, 96, 193, 215, 263, 278
FatI CATG 3 cut(s) 24, 191, 213
HaeIII GGCC 1 cut(s) 88
Hin1II CATG 3 cut(s) 28, 195, 217
HincII GTYRAC 1 cut(s) 158
HindII GTYRAC 1 cut(s) 158
Hpy166II GTNNAC 3 cut(s) 113, 158, 240
Hpy188I TCNGA 1 cut(s) 272
Hpy8I GTNNAC 3 cut(s) 113, 158, 240
HpyAV CCTTC 3 cut(s) 41, 78, 184
HpyCH4V TGCA 5 cut(s) 64, 105, 113, 118, 213
Hsp92II CATG 3 cut(s) 28, 195, 217
Kzo9I GATC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 5 cut(s) 6, 50, 163, 234, 261
LweI GCATC 1 cut(s) 136
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MfeI CAATTG 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 115
MluCI AATT 2 cut(s) 75, 106
MnlI CCTC 2 cut(s) 123, 255
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 249
MunI CAATTG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 249
NdeII GATC 1 cut(s) 203
NlaIII CATG 3 cut(s) 28, 195, 217
NlaIV GGNNCC 1 cut(s) 253
NspI RCATGY 1 cut(s) 217
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
PspN4I GGNNCC 1 cut(s) 253
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 1 cut(s) 203
ScrFI CCNGG 1 cut(s) 249
SduI GDGCHC 1 cut(s) 115
SetI ASST 2 cut(s) 11, 19
SfaNI GCATC 1 cut(s) 136
SmiMI CAYNNNNRTG 1 cut(s) 260
Sse9I AATT 2 cut(s) 75, 106
StyD4I CCNGG 1 cut(s) 247
TasI AATT 2 cut(s) 75, 106
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 120
VneI GTGCAC 1 cut(s) 111
XceI RCATGY 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.