RchiOBHm_Chr4g0393981

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0001210
Physical Location & Seq
Reverse (-)
9665881 .. 9668098
2218 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36651

Sequence Viewer

Length: 180 bp
ATGGAATATGATCAATGGGATTTGGGAGCTCCTCCCTTCTCGCAACTTCTAGTGTGGGGTTGGGGAATCCCCAATACATTTTTATTAGGGATTGGGGCGGGGATGGAGGTAGAGAATGACCCCAGAGATGGGGATGGTATTGTGATCCTCATCCCCAACCCGCCCCATTGTCATCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.5

Weight (kDa)

4.05

Isoelectric Point (pI)

26.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 98, 161
AclWI GGATC 1 cut(s) 139
AfiI CCNNNNNNNGG 2 cut(s) 128, 129
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw21I GWGCWC 1 cut(s) 31
AlwI GGATC 1 cut(s) 139
BanII GRGCYC 1 cut(s) 31
Bbv12I GWGCWC 1 cut(s) 31
BccI CCATC 3 cut(s) 97, 122, 128
BclI TGATCA 1 cut(s) 10
BfaI CTAG 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 129
Bse8I GATNNNNATC 1 cut(s) 149
BseGI GGATG 4 cut(s) 108, 139, 150, 172
BseJI GATNNNNATC 1 cut(s) 149
BseLI CCNNNNNNNGG 2 cut(s) 128, 129
BseRI GAGGAG 1 cut(s) 21
BsiHKAI GWGCWC 1 cut(s) 31
BslI CCNNNNNNNGG 2 cut(s) 128, 129
Bsp1286I GDGCHC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 10, 144
BspACI CCGC 2 cut(s) 98, 161
BspPI GGATC 1 cut(s) 139
BssMI GATC 2 cut(s) 10, 144
BstF5I GGATG 4 cut(s) 108, 139, 150, 172
BstKTI GATC 2 cut(s) 13, 147
BstMBI GATC 2 cut(s) 10, 144
BtsCI GGATG 4 cut(s) 108, 139, 150, 172
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DpnI GATC 2 cut(s) 12, 146
DpnII GATC 2 cut(s) 10, 144
Ecl136II GAGCTC 1 cut(s) 29
Eco24I GRGCYC 1 cut(s) 31
Eco53kI GAGCTC 1 cut(s) 29
EcoICRI GAGCTC 1 cut(s) 29
EcoT38I GRGCYC 1 cut(s) 31
FaiI YATR 1 cut(s) 9
FauI CCCGC 2 cut(s) 91, 168
FbaI TGATCA 1 cut(s) 10
FokI GGATG 4 cut(s) 115, 137, 146, 159
FriOI GRGCYC 1 cut(s) 31
FspBI CTAG 1 cut(s) 50
HinfI GANTC 1 cut(s) 66
HpyAV CCTTC 1 cut(s) 46
Ksp22I TGATCA 1 cut(s) 10
Kzo9I GATC 2 cut(s) 10, 144
LmnI GCTCC 2 cut(s) 26, 34
LpnPI CCDG 1 cut(s) 136
MaeI CTAG 1 cut(s) 50
MalI GATC 2 cut(s) 12, 146
MboI GATC 2 cut(s) 10, 144
MhlI GDGCHC 1 cut(s) 31
MnlI CCTC 3 cut(s) 42, 100, 158
NdeII GATC 2 cut(s) 10, 144
PfeI GAWTC 1 cut(s) 66
Psp124BI GAGCTC 1 cut(s) 31
SacI GAGCTC 1 cut(s) 31
Sau3AI GATC 2 cut(s) 10, 144
SduI GDGCHC 1 cut(s) 31
SetI ASST 2 cut(s) 31, 111
SgeI CNNG 5 cut(s) 52, 62, 111, 135, 172
SsiI CCGC 2 cut(s) 98, 161
SspMI CTAG 1 cut(s) 50
SstI GAGCTC 1 cut(s) 31
TfiI GAWTC 1 cut(s) 66
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.