Prupe.7G254300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0001210
Physical Location & Seq
Forward (+)
21393998 .. 21394714
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G254300.1

Sequence Viewer

Length: 309 bp
ATGACTACAGCGGGAGTTTCTGGGATGATGTTTCAGAGTGTGTTTGAAGGAAGCCTATCAATGCAGGACATGGAAGTTGAGCGAAGGCCATACCATAAAAACTGCAGTTGTGCGCTTCACAAATCCAAGGGGGGTGTTTGCTCCAATGCTTGTCCTCAAAAAAGGAACATTTCCTTTCCAAAGAAACTGTCATGGACTGACGACTATCGAAGTTCACATGTTCTTCTATTCCTGATTCTACACTCTACTCTGTTAACATTCTTTCTGCACTGGCACAGTATATGCCTCTACTACAACATTAGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.71

Weight (kDa)

8.91

Isoelectric Point (pI)

64.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AflIII ACRYGT 1 cut(s) 217
AgsI TTSAA 1 cut(s) 47
AoxI GGCC 1 cut(s) 86
ArsI GACNNNNNNTTYG 2 cut(s) 173, 205
AspLEI GCGC 1 cut(s) 115
BfmI CTRYAG 2 cut(s) 6, 103
BsaJI CCNNGG 1 cut(s) 126
Bse1I ACTGG 1 cut(s) 275
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 275
BsgI GTGCAG 1 cut(s) 251
BshFI GGCC 1 cut(s) 88
BsnI GGCC 1 cut(s) 88
BspACI CCGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 88
BspMAI CTGCAG 1 cut(s) 107
BsrI ACTGG 1 cut(s) 275
BssECI CCNNGG 1 cut(s) 126
BssT1I CCWWGG 1 cut(s) 126
Bst4CI ACNGT 2 cut(s) 189, 278
BstF5I GGATG 1 cut(s) 30
BstHHI GCGC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 221
BstSFI CTRYAG 2 cut(s) 6, 103
BsuRI GGCC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 30
BtsIMutI CAGTG 1 cut(s) 268
CfoI GCGC 1 cut(s) 115
CviAII CATG 3 cut(s) 70, 192, 218
CviJI RGCY 2 cut(s) 54, 88
CviKI_1 RGCY 2 cut(s) 54, 88
Eco130I CCWWGG 1 cut(s) 126
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 3 cut(s) 73, 195, 221
FaiI YATR 7 cut(s) 71, 91, 96, 193, 219, 281, 283
FatI CATG 3 cut(s) 69, 191, 217
FauI CCCGC 1 cut(s) 4
FokI GGATG 1 cut(s) 37
GlaI GCGC 1 cut(s) 114
HaeIII GGCC 1 cut(s) 88
HhaI GCGC 1 cut(s) 115
Hin1II CATG 3 cut(s) 73, 195, 221
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HincII GTYRAC 1 cut(s) 255
HindII GTYRAC 1 cut(s) 255
HinfI GANTC 1 cut(s) 235
HpaI GTTAAC 1 cut(s) 255
Hpy166II GTNNAC 2 cut(s) 215, 255
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 232
Hpy8I GTNNAC 2 cut(s) 215, 255
HpyAV CCTTC 2 cut(s) 41, 78
HpyCH4III ACNGT 2 cut(s) 189, 278
HpyCH4V TGCA 3 cut(s) 64, 105, 268
Hsp92II CATG 3 cut(s) 73, 195, 221
HspAI GCGC 1 cut(s) 113
KspAI GTTAAC 1 cut(s) 255
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 4 cut(s) 6, 50, 245, 256
MboII GAAGA 1 cut(s) 215
MnlI CCTC 2 cut(s) 165, 296
MseI TTAA 1 cut(s) 254
MspA1I CMGCKG 1 cut(s) 11
NlaIII CATG 3 cut(s) 73, 195, 221
NspI RCATGY 1 cut(s) 221
PciI ACATGT 1 cut(s) 217
PfeI GAWTC 1 cut(s) 235
PscI ACATGT 1 cut(s) 217
PstI CTGCAG 1 cut(s) 107
SaqAI TTAA 1 cut(s) 254
SfcI CTRYAG 2 cut(s) 6, 103
SsiI CCGC 1 cut(s) 11
StyI CCWWGG 1 cut(s) 126
TaaI ACNGT 2 cut(s) 189, 278
TaqI TCGA 1 cut(s) 208
TfiI GAWTC 1 cut(s) 235
Tru1I TTAA 1 cut(s) 254
Tru9I TTAA 1 cut(s) 254
TscAI CASTG 1 cut(s) 275
TspRI CASTG 1 cut(s) 275
XceI RCATGY 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.