pycom17g02020

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
1273225 .. 1273563
339 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g02020.1

Sequence Viewer

Length: 339 bp
ATGCGTGGTCTTGGTTTCAAAGAAATTATCTCCTTCAATCCCTCTTTGCTTGCAAAAATATGTTGGAGGCTTATTATGGAACCGGACTTTTTTCTTGGACAAATTTTGCACGCCAAATACTTTCCAAATTCTACTTCCAAACAGGAAGAGGCACATCATGGGGTTGGAAAGGGATATTGCAAGGATGGACGATCCTACGAGCTGGAATCCGATAGAGGGTTGGTGATGGGAAACAAATACGAGTTAAGCACAATCCATGGTTGCCTACTCCTAGAACTTTACCATGAGAATATGCTGGAACGAGTGGTGGATTTGATTGATAGTAGCATTGGCCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.78

Weight (kDa)

5.92

Isoelectric Point (pI)

26.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 186
AcoI YGGCCR 1 cut(s) 331
AcsI RAATTY 2 cut(s) 102, 127
AfiI CCNNNNNNNGG 1 cut(s) 216
AgsI TTSAA 2 cut(s) 19, 37
AjuI GAANNNNNNNTTGG 2 cut(s) 118, 150
AluBI AGCT 1 cut(s) 202
AluI AGCT 1 cut(s) 202
AlwI GGATC 1 cut(s) 186
AoxI GGCC 1 cut(s) 331
ApoI RAATTY 2 cut(s) 102, 127
AsuHPI GGTGA 1 cut(s) 235
BalI TGGCCA 1 cut(s) 333
BccI CCATC 2 cut(s) 179, 220
BfaI CTAG 1 cut(s) 272
BmiI GGNNCC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 256
BsaWI WCCGGW 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 216
BseDI CCNNGG 1 cut(s) 256
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 216
BshFI GGCC 1 cut(s) 333
BsiSI CCGG 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 216
BsnI GGCC 1 cut(s) 333
Bsp143I GATC 1 cut(s) 191
Bsp19I CCATGG 1 cut(s) 256
BspANI GGCC 1 cut(s) 333
BspLI GGNNCC 1 cut(s) 81
BspPI GGATC 1 cut(s) 186
BssECI CCNNGG 1 cut(s) 256
BssMI GATC 1 cut(s) 191
BssT1I CCWWGG 1 cut(s) 256
Bst6I CTCTTC 1 cut(s) 141
BstC8I GCNNGC 2 cut(s) 51, 111
BstDSI CCRYGG 1 cut(s) 256
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 1 cut(s) 194
BstMBI GATC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 333
BtgI CCRYGG 1 cut(s) 256
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 2 cut(s) 51, 111
CviAII CATG 3 cut(s) 158, 257, 284
CviJI RGCY 3 cut(s) 70, 202, 333
CviKI_1 RGCY 3 cut(s) 70, 202, 333
DpnI GATC 1 cut(s) 193
DpnII GATC 1 cut(s) 191
EaeI YGGCCR 1 cut(s) 331
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 256
EcoT14I CCWWGG 1 cut(s) 256
ErhI CCWWGG 1 cut(s) 256
FaeI CATG 3 cut(s) 161, 260, 287
FaiI YATR 6 cut(s) 61, 77, 159, 258, 285, 293
FatI CATG 3 cut(s) 157, 256, 283
FokI GGATG 1 cut(s) 197
FspBI CTAG 1 cut(s) 272
HaeIII GGCC 1 cut(s) 333
HapII CCGG 1 cut(s) 83
Hin1II CATG 3 cut(s) 161, 260, 287
HinfI GANTC 1 cut(s) 206
HpaII CCGG 1 cut(s) 83
HphI GGTGA 1 cut(s) 235
Hpy188I TCNGA 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 43
HpyCH4V TGCA 3 cut(s) 53, 109, 180
Hsp92II CATG 3 cut(s) 161, 260, 287
Kzo9I GATC 1 cut(s) 191
LpnPI CCDG 4 cut(s) 96, 128, 188, 281
MaeI CTAG 1 cut(s) 272
MalI GATC 1 cut(s) 193
MboI GATC 1 cut(s) 191
MboII GAAGA 1 cut(s) 158
MlsI TGGCCA 1 cut(s) 333
MluCI AATT 3 cut(s) 24, 102, 127
MluNI TGGCCA 1 cut(s) 333
MmeI TCCRAC 2 cut(s) 44, 145
MnlI CCTC 4 cut(s) 52, 60, 142, 209
Mox20I TGGCCA 1 cut(s) 333
MscI TGGCCA 1 cut(s) 333
MseI TTAA 1 cut(s) 245
Msp20I TGGCCA 1 cut(s) 333
MspI CCGG 1 cut(s) 83
NcoI CCATGG 1 cut(s) 256
NdeII GATC 1 cut(s) 191
NlaIII CATG 3 cut(s) 161, 260, 287
NlaIV GGNNCC 1 cut(s) 81
PfeI GAWTC 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 245
Sau3AI GATC 1 cut(s) 191
SetI ASST 1 cut(s) 204
Sse9I AATT 3 cut(s) 24, 102, 127
SspMI CTAG 1 cut(s) 272
StyI CCWWGG 1 cut(s) 256
TasI AATT 3 cut(s) 24, 102, 127
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 245
Tru9I TTAA 1 cut(s) 245
XapI RAATTY 2 cut(s) 102, 127
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.