Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001174.1

Orthogroup ID

OG0002038

Physical Location & Seq

Genomic Coordinates Forward (+)

50494 .. 52434

Gene Structure 1941 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001174.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atggttcacagtgacattaaatccgctaatattctttttgatagataccttaaggctaaaatatcagactttggattggcaaccctttacaccgaagttgatcaattcaagttcatcaaagtaggaagtgtcacaatagcgcttgaagaagaagtcaggtcacgggactaccccaacgactgcaccccgcggtgctggcacgcctgcgcaactactcgctcaaaagagactgtttgcacaccagctggttttggagccaaacattttggcatgcccagtgggaccaagctagagtcttttgtgttcaccatcattgggatgctagaggaaaatctttaccaaaggagattcctaaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_1 Malectin Pkinase Pkinase_Tyr

Protein Analysis

119

Amino Acids

13.54

Weight (kDa)

8.37

Isoelectric Point (pI)

47.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002038)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14700
pyrus_communis	pycom17g02020
rosa_chinensis	RchiOBHm_Chr3g0457301
rosa_laevigata	RLG00000011732 RLG00000013316 RLG00000023211
rosa_multiflora	Rmu_sc0000435.1_g000066 Rmu_sc0000469.1_g000012 Rmu_sc0001174.1_g000016 Rmu_sc0001522.1_g000016 Rmu_sc0001605.1_g000006 Rmu_sc0002281.1_g000040 Rmu_sc0003961.1_g000001 Rmu_sc0004538.1_g000008 Rmu_sc0004849.1_g000022 Rmu_sc0006059.1_g000058 Rmu_sc0006244.1_g000015 Rmu_sc0006388.1_g000024 Rmu_sc0007199.1_g000007 Rmu_sc0009454.1_g000015 Rmu_sc0010445.1_g000010 Rmu_sc0010674.1_g000009 Rmu_sc0012734.1_g000004 Rmu_sc0016141.1_g000003 Rmu_ssc0000054.1_g000018
rosa_roxburghii	Rroxscaffold_1G00013820 Rroxscaffold_1G00019140 Rroxscaffold_2G00143180 Rroxscaffold_3G00228590 Rroxscaffold_3G00231450 Rroxscaffold_3G00272460 Rroxscaffold_4G00284560 Rroxscaffold_5G00338350 Rroxscaffold_5G00353580 Rroxscaffold_5G00357860 Rroxscaffold_5G00358350 Rroxscaffold_6G00397580 Rroxscaffold_6G00410760 Rroxscaffold_7G00170980
rosa_samantha	Rh1BG033600 Rh5AG320100 Rh6AG217600 Rh7DG178100
rosa_wichuraiana	Rw1G018200 Rw6G018990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	208
AccII	CGCG	1 cut(s)	190
AciI	CCGC	3 cut(s)	24, 188, 190
AfeI	AGCGCT	1 cut(s)	141
AfiI	CCNNNNNNNGG	1 cut(s)	315
AflII	CTTAAG	1 cut(s)	50
AgsI	TTSAA	2 cut(s)	109, 146
AluBI	AGCT	2 cut(s)	245, 289
AluI	AGCT	2 cut(s)	245, 289
Alw26I	GTCTC	1 cut(s)	221
Aor51HI	AGCGCT	1 cut(s)	141
AspLEI	GCGC	2 cut(s)	142, 209
AspS9I	GGNCC	1 cut(s)	282
AsuHPI	GGTGA	1 cut(s)	298
AvaII	GGWCC	1 cut(s)	282
BccI	CCATC	1 cut(s)	317
BclI	TGATCA	1 cut(s)	100
BcoDI	GTCTC	1 cut(s)	221
BfaI	CTAG	2 cut(s)	290, 323
BfoI	RGCGCY	1 cut(s)	143
BfrI	CTTAAG	1 cut(s)	50
Bme18I	GGWCC	1 cut(s)	282
BmgT120I	GGNCC	1 cut(s)	282
BmiI	GGNNCC	2 cut(s)	256, 283
BmrI	ACTGGG	1 cut(s)	270
BmsI	GCATC	1 cut(s)	309
BmuI	ACTGGG	1 cut(s)	270
BsaJI	CCNNGG	1 cut(s)	188
Bsc4I	CCNNNNNNNGG	1 cut(s)	315
Bse1I	ACTGG	1 cut(s)	276
BseDI	CCNNGG	1 cut(s)	188
BseGI	GGATG	1 cut(s)	324
BseLI	CCNNNNNNNGG	1 cut(s)	315
BseNI	ACTGG	1 cut(s)	276
BsgI	GTGCAG	1 cut(s)	166
Bsh1236I	CGCG	1 cut(s)	190
BslFI	GGGAC	2 cut(s)	179, 295
BslI	CCNNNNNNNGG	1 cut(s)	315
BsmAI	GTCTC	1 cut(s)	221
BsmFI	GGGAC	2 cut(s)	179, 295
Bsp143I	GATC	1 cut(s)	100
BspACI	CCGC	3 cut(s)	24, 188, 190
BspFNI	CGCG	1 cut(s)	190
BspLI	GGNNCC	2 cut(s)	256, 283
BspTI	CTTAAG	1 cut(s)	50
BsrI	ACTGG	1 cut(s)	276
BssECI	CCNNGG	1 cut(s)	188
BssMI	GATC	1 cut(s)	100
Bst4CI	ACNGT	2 cut(s)	11, 232
BstAFI	CTTAAG	1 cut(s)	50
BstC8I	GCNNGC	4 cut(s)	197, 201, 205, 272
BstDSI	CCRYGG	1 cut(s)	188
BstF5I	GGATG	1 cut(s)	324
BstFNI	CGCG	1 cut(s)	190
BstH2I	RGCGCY	1 cut(s)	143
BstHHI	GCGC	2 cut(s)	142, 209
BstKTI	GATC	1 cut(s)	103
BstMAI	GTCTC	1 cut(s)	221
BstMBI	GATC	1 cut(s)	100
BstMWI	GCNNNNNNNGC	1 cut(s)	196
BstNSI	RCATGY	1 cut(s)	274
BstUI	CGCG	1 cut(s)	190
BtgI	CCRYGG	1 cut(s)	188
BtsCI	GGATG	1 cut(s)	324
BtsIMutI	CAGTG	2 cut(s)	16, 283
Cac8I	GCNNGC	4 cut(s)	197, 201, 205, 272
CfoI	GCGC	2 cut(s)	142, 209
Cfr13I	GGNCC	1 cut(s)	282
Cfr42I	CCGCGG	1 cut(s)	191
CviAII	CATG	1 cut(s)	271
CviJI	RGCY	4 cut(s)	56, 245, 257, 289
CviKI_1	RGCY	4 cut(s)	56, 245, 257, 289
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
Eco47I	GGWCC	1 cut(s)	282
Eco47III	AGCGCT	1 cut(s)	141
FaeI	CATG	1 cut(s)	274
FaiI	YATR	1 cut(s)	272
FaqI	GGGAC	2 cut(s)	179, 295
FatI	CATG	1 cut(s)	270
FauI	CCCGC	1 cut(s)	195
FbaI	TGATCA	1 cut(s)	100
FokI	GGATG	1 cut(s)	331
FspBI	CTAG	2 cut(s)	290, 323
FspI	TGCGCA	1 cut(s)	208
GlaI	GCGC	2 cut(s)	141, 208
HaeII	RGCGCY	1 cut(s)	143
HhaI	GCGC	2 cut(s)	142, 209
Hin1II	CATG	1 cut(s)	274
Hin6I	GCGC	2 cut(s)	140, 207
HinP1I	GCGC	2 cut(s)	140, 207
HinfI	GANTC	2 cut(s)	293, 348
HphI	GGTGA	1 cut(s)	298
Hpy166II	GTNNAC	2 cut(s)	7, 306
Hpy188I	TCNGA	1 cut(s)	67
Hpy8I	GTNNAC	2 cut(s)	7, 306
HpyCH4III	ACNGT	2 cut(s)	11, 232
HpyCH4V	TGCA	2 cut(s)	183, 237
HpyF10VI	GCNNNNNNNGC	1 cut(s)	196
Hsp92II	CATG	1 cut(s)	274
HspAI	GCGC	2 cut(s)	140, 207
Ksp22I	TGATCA	1 cut(s)	100
KspI	CCGCGG	1 cut(s)	191
Kzo9I	GATC	1 cut(s)	100
LmnI	GCTCC	1 cut(s)	254
LpnPI	CCDG	6 cut(s)	142, 181, 217, 231, 255, 289
LweI	GCATC	1 cut(s)	309
MaeI	CTAG	2 cut(s)	290, 323
MaeIII	GTNAC	3 cut(s)	11, 130, 159
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MboII	GAAGA	2 cut(s)	158, 161
MluCI	AATT	1 cut(s)	104
MlyI	GAGTC	1 cut(s)	302
MnlI	CCTC	1 cut(s)	319
MseI	TTAA	2 cut(s)	18, 51
MslI	CAYNNNNRTG	1 cut(s)	317
MspA1I	CMGCKG	2 cut(s)	190, 245
MspCI	CTTAAG	1 cut(s)	50
MvnI	CGCG	1 cut(s)	190
MwoI	GCNNNNNNNGC	1 cut(s)	196
NdeII	GATC	1 cut(s)	100
NlaIII	CATG	1 cut(s)	274
NlaIV	GGNNCC	2 cut(s)	256, 283
NmuCI	GTSAC	3 cut(s)	11, 130, 159
NsbI	TGCGCA	1 cut(s)	208
NspI	RCATGY	1 cut(s)	274
PaeI	GCATGC	1 cut(s)	274
PfeI	GAWTC	1 cut(s)	348
PleI	GAGTC	1 cut(s)	301
PpsI	GAGTC	1 cut(s)	301
PspN4I	GGNNCC	2 cut(s)	256, 283
PspPI	GGNCC	1 cut(s)	282
PvuII	CAGCTG	1 cut(s)	245
RseI	CAYNNNNRTG	1 cut(s)	317
SacII	CCGCGG	1 cut(s)	191
SaqAI	TTAA	2 cut(s)	18, 51
Sau3AI	GATC	1 cut(s)	100
Sau96I	GGNCC	1 cut(s)	282
SchI	GAGTC	1 cut(s)	302
SetI	ASST	4 cut(s)	51, 161, 247, 291
SfaNI	GCATC	1 cut(s)	309
Sfr303I	CCGCGG	1 cut(s)	191
SgrBI	CCGCGG	1 cut(s)	191
SinI	GGWCC	1 cut(s)	282
SmiMI	CAYNNNNRTG	1 cut(s)	317
SmlI	CTYRAG	1 cut(s)	50
SmoI	CTYRAG	1 cut(s)	50
SphI	GCATGC	1 cut(s)	274
Sse9I	AATT	1 cut(s)	104
SsiI	CCGC	3 cut(s)	24, 188, 190
SspI	AATATT	1 cut(s)	31
SspMI	CTAG	2 cut(s)	290, 323
TaaI	ACNGT	2 cut(s)	11, 232
TasI	AATT	1 cut(s)	104
TfiI	GAWTC	1 cut(s)	348
Tru1I	TTAA	2 cut(s)	18, 51
Tru9I	TTAA	2 cut(s)	18, 51
TscAI	CASTG	2 cut(s)	16, 283
TseFI	GTSAC	3 cut(s)	11, 130, 159
Tsp45I	GTSAC	3 cut(s)	11, 130, 159
TspDTI	ATGAA	1 cut(s)	103
TspRI	CASTG	2 cut(s)	16, 283
Vha464I	CTTAAG	1 cut(s)	50
VpaK11BI	GGWCC	1 cut(s)	282
XceI	RCATGY	1 cut(s)	274
XspI	CTAG	2 cut(s)	290, 323

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.