Rroxscaffold_1G00019140

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
23338040 .. 23341567
3528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00019140.1

Sequence Viewer

Length: 282 bp
ATGAAATTTTCTATCTATTACGACTCCGGTGAGGAGCACCATAACAATCGCTCACCTTCACCGACACTCTCAATCTTAGAGAAGAAAATGAGGTTGGTGCTCTCCTCGTCCACATCGTTTGATTCAAGAAGTCAGGTCAAGGGACTCCCCGACGACTACACCTCACGATCTTTGGCATGCCTGCACACACGCTCAAAAGAGACAGGTTGCAAGGCAAGCTGGTTTTGGAGCCAAATAGATGGCTCAAGTGAGCTGTTTACAATCATTCTCAAGTACATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.63

Weight (kDa)

8.62

Isoelectric Point (pI)

79.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 275
AgsI TTSAA 1 cut(s) 126
AjuI GAANNNNNNNTTGG 2 cut(s) 77, 109
AluBI AGCT 2 cut(s) 219, 253
AluI AGCT 2 cut(s) 219, 253
Alw21I GWGCWC 2 cut(s) 39, 102
Alw26I GTCTC 1 cut(s) 194
ApoI RAATTY 1 cut(s) 5
AsuHPI GGTGA 3 cut(s) 41, 45, 51
Bbv12I GWGCWC 2 cut(s) 39, 102
BccI CCATC 1 cut(s) 233
BcoDI GTCTC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 230
BpuEI CTTGAG 2 cut(s) 229, 254
BsaWI WCCGGW 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 47, 94
BsgI GTGCAG 1 cut(s) 167
BsiHKAI GWGCWC 2 cut(s) 39, 102
BsiSI CCGG 1 cut(s) 27
BslFI GGGAC 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 156
Bsp1286I GDGCHC 2 cut(s) 39, 102
Bsp143I GATC 1 cut(s) 167
BspLI GGNNCC 1 cut(s) 230
BssMI GATC 1 cut(s) 167
BstC8I GCNNGC 3 cut(s) 178, 182, 217
BstDEI CTNAG 1 cut(s) 76
BstKTI GATC 1 cut(s) 170
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstNSI RCATGY 1 cut(s) 180
BstXI CCANNNNNNTGG 1 cut(s) 239
Cac8I GCNNGC 3 cut(s) 178, 182, 217
Csp6I GTAC 1 cut(s) 274
CspCI CAANNNNNGTGG 2 cut(s) 100, 135
CviAII CATG 1 cut(s) 177
CviJI RGCY 4 cut(s) 219, 231, 243, 253
CviKI_1 RGCY 4 cut(s) 219, 231, 243, 253
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 1 cut(s) 76
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
FaeI CATG 1 cut(s) 180
FaiI YATR 2 cut(s) 42, 178
FaqI GGGAC 1 cut(s) 156
FatI CATG 1 cut(s) 176
HapII CCGG 1 cut(s) 27
Hin1II CATG 1 cut(s) 180
HinfI GANTC 3 cut(s) 23, 122, 144
HpaII CCGG 1 cut(s) 27
HphI GGTGA 3 cut(s) 41, 45, 51
Hpy166II GTNNAC 2 cut(s) 111, 258
Hpy188III TCNNGA 2 cut(s) 126, 165
Hpy8I GTNNAC 2 cut(s) 111, 258
Hpy99I CGWCG 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 184, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
HpyF3I CTNAG 1 cut(s) 76
Hsp92II CATG 1 cut(s) 180
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 2 cut(s) 34, 228
LpnPI CCDG 5 cut(s) 40, 119, 189, 194, 205
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MboII GAAGA 1 cut(s) 94
MhlI GDGCHC 2 cut(s) 39, 102
MluCI AATT 1 cut(s) 5
MlyI GAGTC 2 cut(s) 17, 138
MnlI CCTC 4 cut(s) 25, 84, 115, 172
MspI CCGG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 216
NdeII GATC 1 cut(s) 167
NlaIII CATG 1 cut(s) 180
NlaIV GGNNCC 1 cut(s) 230
NspI RCATGY 1 cut(s) 180
PaeI GCATGC 1 cut(s) 180
PcsI WCGNNNNNNNCGW 1 cut(s) 113
PfeI GAWTC 1 cut(s) 122
PleI GAGTC 2 cut(s) 17, 138
PpsI GAGTC 2 cut(s) 17, 138
PspN4I GGNNCC 1 cut(s) 230
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
Sau3AI GATC 1 cut(s) 167
SchI GAGTC 2 cut(s) 17, 138
SduI GDGCHC 2 cut(s) 39, 102
SetI ASST 7 cut(s) 58, 95, 138, 164, 208, 221, 255
SmlI CTYRAG 2 cut(s) 244, 269
SmoI CTYRAG 2 cut(s) 244, 269
SphI GCATGC 1 cut(s) 180
Sse9I AATT 1 cut(s) 5
TasI AATT 1 cut(s) 5
TatI WGTACW 1 cut(s) 273
TfiI GAWTC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 5
XceI RCATGY 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.