Rh5AG320100

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
47398636 .. 47412159
13524 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG320100.1

Sequence Viewer

Length: 180 bp
ATGTCAAGAGGAGAACCACTGACCCTACTAATTGGCGGGTTTCTTATAGTCGTCTTCTCTCATATTAAAGTGCGGCTAGAGAATTGTAGCTTTGATGCGGCCAAAAAAGGTCACAGAGCCTCCTGGGGATGGTCAAGGCTACTAGAAGCTCGGGATTTCATCACTCAACACTGTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.66

Weight (kDa)

9.38

Isoelectric Point (pI)

27.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 36, 73, 98
AcoI YGGCCR 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 129
AjnI CCWGG 1 cut(s) 122
AluBI AGCT 2 cut(s) 90, 149
AluI AGCT 2 cut(s) 90, 149
Ama87I CYCGRG 1 cut(s) 150
AoxI GGCC 1 cut(s) 99
AvaI CYCGRG 1 cut(s) 150
BbsI GAAGAC 1 cut(s) 46
BccI CCATC 1 cut(s) 123
BciT130I CCWGG 1 cut(s) 124
BfaI CTAG 2 cut(s) 77, 143
BisI GCNGC 2 cut(s) 74, 99
BlsI GCNGC 2 cut(s) 75, 100
Bme1390I CCNGG 1 cut(s) 124
BmeT110I CYCGRG 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 124
BmsI GCATC 1 cut(s) 85
BpiI GAAGAC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 123
BsaXI ACNNNNNCTCC 2 cut(s) 104, 134
Bsc4I CCNNNNNNNGG 1 cut(s) 129
BseBI CCWGG 1 cut(s) 124
BseDI CCNNGG 1 cut(s) 123
BseGI GGATG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 101
BsiHKCI CYCGRG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 129
BsnI GGCC 1 cut(s) 101
BsoBI CYCGRG 1 cut(s) 150
BspACI CCGC 3 cut(s) 36, 73, 98
BspANI GGCC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 124
Bst4CI ACNGT 1 cut(s) 173
BstF5I GGATG 1 cut(s) 134
BstNI CCWGG 1 cut(s) 124
BstSCI CCNGG 1 cut(s) 122
BstV2I GAAGAC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 134
BtsIMutI CAGTG 2 cut(s) 17, 169
CviJI RGCY 7 cut(s) 76, 90, 101, 119, 139, 149, 177
CviKI_1 RGCY 7 cut(s) 76, 90, 101, 119, 139, 149, 177
EaeI YGGCCR 1 cut(s) 99
Eco88I CYCGRG 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 122
FaiI YATR 2 cut(s) 47, 63
FauI CCCGC 1 cut(s) 29
Fnu4HI GCNGC 2 cut(s) 74, 99
FokI GGATG 1 cut(s) 141
Fsp4HI GCNGC 2 cut(s) 74, 99
FspBI CTAG 2 cut(s) 77, 143
GluI GCNGC 2 cut(s) 74, 99
HaeIII GGCC 1 cut(s) 101
Hpy188III TCNNGA 2 cut(s) 6, 152
HpyCH4III ACNGT 1 cut(s) 173
LpnPI CCDG 2 cut(s) 109, 136
LweI GCATC 1 cut(s) 85
MaeI CTAG 2 cut(s) 77, 143
MaeIII GTNAC 1 cut(s) 110
MboII GAAGA 1 cut(s) 46
MluCI AATT 2 cut(s) 30, 82
MnlI CCTC 1 cut(s) 130
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 124
MvaI CCWGG 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 110
PkrI GCNGC 2 cut(s) 75, 100
Psp6I CCWGG 1 cut(s) 122
PspGI CCWGG 1 cut(s) 122
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 2 cut(s) 74, 99
ScrFI CCNGG 1 cut(s) 124
SetI ASST 3 cut(s) 92, 112, 151
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 9 cut(s) 18, 49, 89, 135, 136, 147, 155, 162, 164
Sse9I AATT 2 cut(s) 30, 82
SsiI CCGC 3 cut(s) 36, 73, 98
SspMI CTAG 2 cut(s) 77, 143
StyD4I CCNGG 1 cut(s) 122
TaaI ACNGT 1 cut(s) 173
TasI AATT 2 cut(s) 30, 82
TauI GCSGC 2 cut(s) 76, 101
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TscAI CASTG 2 cut(s) 24, 176
TseFI GTSAC 1 cut(s) 110
Tsp45I GTSAC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 148
TspRI CASTG 2 cut(s) 24, 176
XspI CTAG 2 cut(s) 77, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.