Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000469.1

Orthogroup ID

OG0002038

Physical Location & Seq

Genomic Coordinates Reverse (-)

52182 .. 54290

Gene Structure 2109 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000469.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 933 bp

atggtactcagatcagctagtgagttgtgcgaaagccactacggttctgcaagacaggcacttcaagagtcaatcaaggatttggaaaatggtaacttcgactctgcaggacgcaaggcaagtgatgctacagaacaagttaagatctgtggaagtgaatttgcaaggttcagtgtcacttatcctctaaacttgacccatcccctttctctcctccatgtccacgatcaccatatctcatcaaacccatcccctttctctcttccatggccacgaccaccacatctcctccaccttccaaatccacacctaccaaactcaaccccatcctcatcaccaatcacctttggtccaccacccaaaatctgccaccagttttaccgtccctcctcaggtccttcgactacgacgagtgttccttattacaccagcgacacctcaacgtcctccgctacttcccaattgatcgggtccctagcggcgacctcaacgtcctcgcgattcaaaactcatagagaactgcaacgtctggctccctctcgccctaattcaaagcctccattcttcctccacttctctgacaatcgagggacaggtggtgaggttgggggtggaggcgtcgacggcagtggtggtggttatgagcagaagggcttgggatttaagaggcaaaatcaacgaagtgaagagagagagagagagagagactgttttacccctcaaaatatgacacgtgtcacacaaactaacgacgtcatgccgtcgacggcagtggtggtggttatgagcagaagggcttgggatttaagaggcaaaatcaacgaagtgaagagagagagagactgttttacccctcaaaatatgacacgtgtcacacaaactaacgacgtcatggacgtcgtgtacatatactgggtcgggtttacaatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

310

Amino Acids

34.38

Weight (kDa)

8.98

Isoelectric Point (pI)

49.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002038)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14700
pyrus_communis	pycom17g02020
rosa_chinensis	RchiOBHm_Chr3g0457301
rosa_laevigata	RLG00000011732 RLG00000013316 RLG00000023211
rosa_multiflora	Rmu_sc0000435.1_g000066 Rmu_sc0000469.1_g000012 Rmu_sc0001174.1_g000016 Rmu_sc0001522.1_g000016 Rmu_sc0001605.1_g000006 Rmu_sc0002281.1_g000040 Rmu_sc0003961.1_g000001 Rmu_sc0004538.1_g000008 Rmu_sc0004849.1_g000022 Rmu_sc0006059.1_g000058 Rmu_sc0006244.1_g000015 Rmu_sc0006388.1_g000024 Rmu_sc0007199.1_g000007 Rmu_sc0009454.1_g000015 Rmu_sc0010445.1_g000010 Rmu_sc0010674.1_g000009 Rmu_sc0012734.1_g000004 Rmu_sc0016141.1_g000003 Rmu_ssc0000054.1_g000018
rosa_roxburghii	Rroxscaffold_1G00013820 Rroxscaffold_1G00019140 Rroxscaffold_2G00143180 Rroxscaffold_3G00228590 Rroxscaffold_3G00231450 Rroxscaffold_3G00272460 Rroxscaffold_4G00284560 Rroxscaffold_5G00338350 Rroxscaffold_5G00353580 Rroxscaffold_5G00357860 Rroxscaffold_5G00358350 Rroxscaffold_6G00397580 Rroxscaffold_6G00410760 Rroxscaffold_7G00170980
rosa_samantha	Rh1BG033600 Rh5AG320100 Rh6AG217600 Rh7DG178100
rosa_wichuraiana	Rw1G018200 Rw6G018990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	490
AatII	GACGTC	3 cut(s)	756, 891, 900
AccI	GTMKAC	2 cut(s)	621, 764
AccII	CGCG	1 cut(s)	499
AciI	CCGC	2 cut(s)	450, 479
AcoI	YGGCCR	1 cut(s)	269
AcsI	RAATTY	1 cut(s)	158
AcvI	CACGTG	2 cut(s)	734, 869
AcyI	GRCGYC	4 cut(s)	618, 753, 888, 897
AfaI	GTAC	2 cut(s)	6, 905
AfiI	CCNNNNNNNGG	1 cut(s)	392
AflIII	ACRYGT	4 cut(s)	731, 733, 866, 868
AgsI	TTSAA	3 cut(s)	65, 505, 552
AluBI	AGCT	1 cut(s)	17
AluI	AGCT	1 cut(s)	17
Alw26I	GTCTC	2 cut(s)	699, 834
AoxI	GGCC	1 cut(s)	269
ApoI	RAATTY	1 cut(s)	158
AspS9I	GGNCC	3 cut(s)	350, 395, 471
AsuHPI	GGTGA	4 cut(s)	221, 327, 334, 611
AvaII	GGWCC	3 cut(s)	350, 395, 471
AxyI	CCTNAGG	1 cut(s)	391
BalI	TGGCCA	1 cut(s)	271
BbrPI	CACGTG	2 cut(s)	734, 869
BccI	CCATC	3 cut(s)	207, 256, 334
BceAI	ACGGC	3 cut(s)	640, 745, 783
BcoDI	GTCTC	2 cut(s)	699, 834
BfaI	CTAG	2 cut(s)	18, 476
BfmI	CTRYAG	2 cut(s)	105, 129
BglII	AGATCT	1 cut(s)	144
BisI	GCNGC	1 cut(s)	480
BlsI	GCNGC	1 cut(s)	481
Bme18I	GGWCC	3 cut(s)	350, 395, 471
BmgT120I	GGNCC	3 cut(s)	350, 395, 471
BmiI	GGNNCC	3 cut(s)	472, 473, 534
BmrI	ACTGGG	1 cut(s)	922
BmsI	GCATC	1 cut(s)	115
BmuI	ACTGGG	1 cut(s)	922
BoxI	GACNNNNGTC	2 cut(s)	734, 869
BsaAI	YACGTR	2 cut(s)	734, 869
BsaHI	GRCGYC	4 cut(s)	618, 753, 888, 897
BsaJI	CCNNGG	1 cut(s)	266
BsaXI	ACNNNNNCTCC	6 cut(s)	270, 273, 300, 303, 371, 401
Bsc4I	CCNNNNNNNGG	1 cut(s)	392
Bse1I	ACTGG	2 cut(s)	373, 917
Bse21I	CCTNAGG	1 cut(s)	391
BseDI	CCNNGG	1 cut(s)	266
BseGI	GGATG	3 cut(s)	199, 248, 326
BseLI	CCNNNNNNNGG	1 cut(s)	392
BseMII	CTCAG	2 cut(s)	22, 405
BseNI	ACTGG	2 cut(s)	373, 917
BseRI	GAGGAG	3 cut(s)	203, 278, 379
Bsh1236I	CGCG	1 cut(s)	499
BshFI	GGCC	1 cut(s)	271
BslFI	GGGAC	3 cut(s)	369, 457, 604
BslI	CCNNNNNNNGG	1 cut(s)	392
BsmAI	GTCTC	2 cut(s)	699, 834
BsmFI	GGGAC	3 cut(s)	369, 457, 604
BsnI	GGCC	1 cut(s)	271
Bsp1407I	TGTACA	1 cut(s)	903
Bsp143I	GATC	4 cut(s)	11, 144, 226, 465
Bsp19I	CCATGG	1 cut(s)	266
Bsp68I	TCGCGA	1 cut(s)	499
BspACI	CCGC	2 cut(s)	450, 479
BspANI	GGCC	1 cut(s)	271
BspCNI	CTCAG	2 cut(s)	21, 404
BspFNI	CGCG	1 cut(s)	499
BspLI	GGNNCC	3 cut(s)	472, 473, 534
BspMAI	CTGCAG	1 cut(s)	109
BsrGI	TGTACA	1 cut(s)	903
BsrI	ACTGG	2 cut(s)	373, 917
BssECI	CCNNGG	1 cut(s)	266
BssMI	GATC	4 cut(s)	11, 144, 226, 465
BssNI	GRCGYC	4 cut(s)	618, 753, 888, 897
BssT1I	CCWWGG	1 cut(s)	266
Bst4CI	ACNGT	4 cut(s)	44, 383, 710, 845
Bst6I	CTCTTC	3 cut(s)	267, 681, 824
BstACI	GRCGYC	4 cut(s)	618, 753, 888, 897
BstAPI	GCANNNNNTGC	1 cut(s)	125
BstAUI	TGTACA	1 cut(s)	903
BstBAI	YACGTR	2 cut(s)	734, 869
BstDEI	CTNAG	2 cut(s)	8, 391
BstDSI	CCRYGG	1 cut(s)	266
BstF5I	GGATG	3 cut(s)	199, 248, 326
BstFNI	CGCG	1 cut(s)	499
BstKTI	GATC	4 cut(s)	14, 147, 229, 468
BstMAI	GTCTC	2 cut(s)	699, 834
BstMBI	GATC	4 cut(s)	11, 144, 226, 465
BstMWI	GCNNNNNNNGC	3 cut(s)	56, 125, 624
BstPAI	GACNNNNGTC	2 cut(s)	734, 869
BstSFI	CTRYAG	2 cut(s)	105, 129
BstUI	CGCG	1 cut(s)	499
BstX2I	RGATCY	1 cut(s)	144
BstYI	RGATCY	1 cut(s)	144
Bsu36I	CCTNAGG	1 cut(s)	391
BsuRI	GGCC	1 cut(s)	271
BtgI	CCRYGG	1 cut(s)	266
BtsCI	GGATG	3 cut(s)	199, 248, 326
BtsI	GCAGTG	2 cut(s)	634, 777
BtsIMutI	CAGTG	3 cut(s)	178, 634, 777
BtuMI	TCGCGA	1 cut(s)	499
Cfr13I	GGNCC	3 cut(s)	350, 395, 471
CseI	GACGC	2 cut(s)	120, 607
Csp6I	GTAC	2 cut(s)	5, 904
CviAII	CATG	4 cut(s)	218, 267, 757, 892
CviJI	RGCY	7 cut(s)	17, 36, 271, 533, 556, 654, 797
CviKI_1	RGCY	7 cut(s)	17, 36, 271, 533, 556, 654, 797
CviQI	GTAC	2 cut(s)	5, 904
DdeI	CTNAG	2 cut(s)	8, 391
DpnI	GATC	4 cut(s)	13, 146, 228, 467
DpnII	GATC	4 cut(s)	11, 144, 226, 465
DrdI	GACNNNNNNGTC	1 cut(s)	490
DseDI	GACNNNNNNGTC	1 cut(s)	490
EaeI	YGGCCR	1 cut(s)	269
Eam1104I	CTCTTC	3 cut(s)	267, 681, 824
EarI	CTCTTC	3 cut(s)	267, 681, 824
Eco130I	CCWWGG	1 cut(s)	266
Eco47I	GGWCC	3 cut(s)	350, 395, 471
Eco72I	CACGTG	2 cut(s)	734, 869
Eco81I	CCTNAGG	1 cut(s)	391
EcoO109I	RGGNCCY	2 cut(s)	395, 471
EcoT14I	CCWWGG	1 cut(s)	266
ErhI	CCWWGG	1 cut(s)	266
FaeI	CATG	4 cut(s)	221, 270, 760, 895
FaqI	GGGAC	3 cut(s)	369, 457, 604
FatI	CATG	4 cut(s)	217, 266, 756, 891
FblI	GTMKAC	2 cut(s)	621, 764
Fnu4HI	GCNGC	1 cut(s)	480
FokI	GGATG	3 cut(s)	186, 235, 313
Fsp4HI	GCNGC	1 cut(s)	480
FspBI	CTAG	2 cut(s)	18, 476
GluI	GCNGC	1 cut(s)	480
HaeIII	GGCC	1 cut(s)	271
HgaI	GACGC	2 cut(s)	120, 607
Hin1I	GRCGYC	4 cut(s)	618, 753, 888, 897
Hin1II	CATG	4 cut(s)	221, 270, 760, 895
HincII	GTYRAC	2 cut(s)	622, 765
HindII	GTYRAC	2 cut(s)	622, 765
HinfI	GANTC	3 cut(s)	68, 101, 501
HphI	GGTGA	4 cut(s)	221, 327, 334, 611
Hpy166II	GTNNAC	6 cut(s)	223, 353, 622, 765, 904, 924
Hpy188I	TCNGA	2 cut(s)	11, 580
Hpy188III	TCNNGA	2 cut(s)	65, 498
Hpy8I	GTNNAC	6 cut(s)	223, 353, 622, 765, 904, 924
Hpy99I	CGWCG	8 cut(s)	412, 623, 626, 755, 766, 769, 890, 902
HpyAV	CCTTC	4 cut(s)	305, 408, 643, 786
HpyCH4III	ACNGT	4 cut(s)	44, 383, 710, 845
HpyCH4IV	ACGT	8 cut(s)	443, 491, 526, 733, 753, 868, 888, 897
HpyCH4V	TGCA	4 cut(s)	50, 107, 164, 523
HpyF10VI	GCNNNNNNNGC	3 cut(s)	56, 125, 624
HpyF3I	CTNAG	2 cut(s)	8, 391
HpySE526I	ACGT	8 cut(s)	443, 491, 526, 733, 753, 868, 888, 897
Hsp92I	GRCGYC	4 cut(s)	618, 753, 888, 897
Hsp92II	CATG	4 cut(s)	221, 270, 760, 895
KflI	GGGWCCC	1 cut(s)	471
Kzo9I	GATC	4 cut(s)	11, 144, 226, 465
LmnI	GCTCC	1 cut(s)	538
LpnPI	CCDG	8 cut(s)	41, 93, 378, 386, 442, 515, 579, 898
LweI	GCATC	1 cut(s)	115
MaeI	CTAG	2 cut(s)	18, 476
MaeII	ACGT	8 cut(s)	443, 491, 526, 733, 753, 868, 888, 897
MaeIII	GTNAC	4 cut(s)	92, 175, 736, 871
MalI	GATC	4 cut(s)	13, 146, 228, 467
MboI	GATC	4 cut(s)	11, 144, 226, 465
MboII	GAAGA	4 cut(s)	254, 556, 698, 841
MfeI	CAATTG	1 cut(s)	461
MflI	RGATCY	1 cut(s)	144
MlsI	TGGCCA	1 cut(s)	271
MluCI	AATT	4 cut(s)	158, 461, 547, 927
MluNI	TGGCCA	1 cut(s)	271
MlyI	GAGTC	2 cut(s)	77, 95
Mox20I	TGGCCA	1 cut(s)	271
MscI	TGGCCA	1 cut(s)	271
MseI	TTAA	3 cut(s)	141, 663, 806
Msp20I	TGGCCA	1 cut(s)	271
MunI	CAATTG	1 cut(s)	461
MvnI	CGCG	1 cut(s)	499
MwoI	GCNNNNNNNGC	3 cut(s)	56, 125, 624
NcoI	CCATGG	1 cut(s)	266
NdeII	GATC	4 cut(s)	11, 144, 226, 465
NlaIII	CATG	4 cut(s)	221, 270, 760, 895
NlaIV	GGNNCC	3 cut(s)	472, 473, 534
NmuCI	GTSAC	3 cut(s)	175, 736, 871
NruI	TCGCGA	1 cut(s)	499
PcsI	WCGNNNNNNNCGW	2 cut(s)	407, 894
PfeI	GAWTC	1 cut(s)	501
PkrI	GCNGC	1 cut(s)	481
PleI	GAGTC	2 cut(s)	76, 95
PmaCI	CACGTG	2 cut(s)	734, 869
PmlI	CACGTG	2 cut(s)	734, 869
PpsI	GAGTC	2 cut(s)	76, 95
Ppu21I	YACGTR	2 cut(s)	734, 869
PpuMI	RGGWCCY	2 cut(s)	395, 471
PshAI	GACNNNNGTC	2 cut(s)	734, 869
Psp5II	RGGWCCY	2 cut(s)	395, 471
PspCI	CACGTG	2 cut(s)	734, 869
PspN4I	GGNNCC	3 cut(s)	472, 473, 534
PspPI	GGNCC	3 cut(s)	350, 395, 471
PspPPI	RGGWCCY	2 cut(s)	395, 471
PstI	CTGCAG	1 cut(s)	109
PsuI	RGATCY	1 cut(s)	144
RruI	TCGCGA	1 cut(s)	499
RsaI	GTAC	2 cut(s)	6, 905
RsaNI	GTAC	2 cut(s)	5, 904
SalI	GTCGAC	2 cut(s)	620, 763
SaqAI	TTAA	3 cut(s)	141, 663, 806
SatI	GCNGC	1 cut(s)	480
Sau3AI	GATC	4 cut(s)	11, 144, 226, 465
Sau96I	GGNCC	3 cut(s)	350, 395, 471
SchI	GAGTC	2 cut(s)	77, 95
SfaNI	GCATC	1 cut(s)	115
SfcI	CTRYAG	2 cut(s)	105, 129
SgrDI	CGTCGACG	2 cut(s)	620, 763
SinI	GGWCC	3 cut(s)	350, 395, 471
Sse9I	AATT	4 cut(s)	158, 461, 547, 927
SsiI	CCGC	2 cut(s)	450, 479
SspMI	CTAG	2 cut(s)	18, 476
StyI	CCWWGG	1 cut(s)	266
TaaI	ACNGT	4 cut(s)	44, 383, 710, 845
TaiI	ACGT	8 cut(s)	446, 494, 529, 736, 756, 871, 891, 900
TaqI	TCGA	5 cut(s)	99, 401, 586, 621, 764
TasI	AATT	4 cut(s)	158, 461, 547, 927
TatI	WGTACW	1 cut(s)	903
TauI	GCSGC	1 cut(s)	482
TfiI	GAWTC	1 cut(s)	501
Tru1I	TTAA	3 cut(s)	141, 663, 806
Tru9I	TTAA	3 cut(s)	141, 663, 806
TscAI	CASTG	3 cut(s)	178, 634, 777
TseFI	GTSAC	3 cut(s)	175, 736, 871
Tsp45I	GTSAC	3 cut(s)	175, 736, 871
TspRI	CASTG	3 cut(s)	178, 634, 777
VpaK11BI	GGWCC	3 cut(s)	350, 395, 471
XapI	RAATTY	1 cut(s)	158
XmiI	GTMKAC	2 cut(s)	621, 764
XspI	CTAG	2 cut(s)	18, 476
ZraI	GACGTC	3 cut(s)	754, 889, 898

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.